Search bioRxiv⌕ Search
Home/Archive/bioRxiv

bioRxiv · 10.1101/2025.06.16.659939

Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans

Lange, K. I.
View original source ↗Export metadata ↓

Abstract

CRISPR/Cas9 genome editing has become an important and routine method in C. elegans research to generate new mutants and endogenously tag genes. One complication of CRISPR experiments is that the efficiency of single-guide RNA sequences can vary dramatically. One solution to this problem is to create an intermediate entry strain using the efficient and well-characterised dpy-10 guide RNA sequence. This "d10 entry strain" can then be used to generate your knock-in of interest. However, the dpy-10 sequence is not always suitable when creating an entry strain. For example, if your gene of interest is closely linked to dpy-10 on LGII or if you want to use the dpy-10 as a co-CRISPR marker for the creation of the entry strain then you can not use the dpy-10 sequence. This publication reports a synthetic guide sequence, GCTATCAACTATCCATATCG, that is not present in the C. elegans genome and can be used to create entry strains. This guide sequence is demonstrated to be relatively robust with a knock-in efficiency that varies from 1-11%. While this is lower than the efficiency observed with d10 entry strains, it is still sufficient for most applications. This guide sequence can be added to the C. elegans CRISPR toolkit and is particularly useful for generating entry strains where the standard dpy-10 guide sequence is not suitable.

Explore related subjects

geneticsPreprint

Keep this discovery

Explore connections, maps & timelines

BibTeXRIS

Lange, K. I.. 2025-06-16. Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans. https://doi.org/10.1101/2025.06.16.659939

Cite the original work for its findings. Save a collection to share your selection of sources.

KEEP EXPLORING

Related preprints

bioRxiv2026

Pangenome Discoveries from Clinical Long-Read Genomes in Underrepresented Populations with Neurodevelopmental Disorders

Genetic diagnoses remain elusive for many individuals with neurodevelopmental disorders (NDDs), and the gap is wider in populations poorly represented in genomic reference resources. To demonstrate the equitable advantage of long-read whole genome sequencing (LR-WGS) and pangenomes in terms of clinical utility, we analyzed 211 NDD cases and 107 unaffected relatives from 24 populations, integrating their assemblies, resulting in a total of 1204 haplotypes with the Human Pangenome Reference Consortium Release 2 (HPRC_r2) and the Arab Pangenome Reference (APR) datasets. Clinical interpretation of small variants and structural variants (SVs) revealed pathogenic or likely pathogenic findings in 38.9% of the cases (82/211), and our workflow further detected pathogenic repeat expansions in 3.8% of the cases and runs of homozygosity (ROHs) exceeding 300 Mb in 4.7% of the cases, revealing substantial autozygosity suggestive of strong inbreeding. Beyond these clinical assessments, pangenome analysis revealed 3.9 million population-level novel small variants, 39,782 SVs and an average of 2.17 Mb of novel sequence per individual absent from linear references and global pangenomes. We identified 85.9 kb of case-unique nonreference sequences in exonic segments overlapping with curated NDD gene sets. Graph-based tertiary analysis further identified rare exonic complex homozygous rearrangements in the NDD associated genes for 2.4% of the cases. Together, these findings emphasize how diverse genome assemblies extend variant discovery beyond established linear reference-based clinical interpretation.

genetics↗
bioRxiv2026

Integrated exome-transcriptome analysis of a schizophrenia case with an exceptionally low polygenic risk score

Schizophrenia liability reflects both common polygenic variation and rarer variants of larger effect. We investigated a post-mortem schizophrenia case (SZ07) with a schizophrenia polygenic risk score below the first percentile among ancestry-matched cases, asking whether individual-level genomic and transcriptomic analyses could help identify potentially novel schizophrenia-relevant variants. We used exome analysis with multiple variant-prediction tools to generate a panel of variants and corresponding candidate genes potentially implicated in the pathological process in SZ07. The prioritised variants were then assessed using RNA sequencing of three cortical regions. Of these, only an IZUMO4 splice-acceptor variant showed direct RNA-level support. Beyond variant-specific analyses, we characterised broader transcriptomic abnormalities in the SZ07 brain. Pathway analysis of gene-level expression deviations implicated innate immune processes, calcium signalling, synaptic biology, and axon remodelling. Notably, compared with conventional single-sample biological pathway analysis, the analysis we used showed only a weak association with neuronal specificity, suggesting their reduced sensitivity to the main axis of variation related to cellular composition in bulk brain tissue gene expression data. Although the candidate genes showed no significant pathway-level convergence, the broader transcriptomic profile revealed coherent biological alterations largely compatible with the documented history of cerebrovascular disease in SZ07. These results demonstrate how the integration of exome and transcriptome data at the individual level enables the formulation and constraint of hypotheses regarding patient-specific genetic features and their molecular consequences, while highlighting important limitations related to tissue composition, comorbidity, and the choice of reference cohort.

genetics↗
bioRxiv2026

A genetic screen to identify host factors required for commensal bacterial adherence to the gut epithelia

Bacterial adherence to gut epithelial cells likely involves host genetic components. We isolated a gut commensal bacterium, Lelliottia jeotgali, that can robustly colonize C. elegans through attachment to intestinal epithelial cells. Here, we developed a novel screen in C. elegans to identify host genes required for microbiome bacterial colonization. Using transgenic L. jeotgali strain expressing tdTomato, we conducted forward genetic screens in C. elegans to select for mutants that completely lost colonization. We identified multiple allelic mutations in five different C. elegans genes, termed knockout of Lelliottia adherence (kola) mutants, with a near complete loss of adherence. Each of kola-1-5 is uncharacterized and predicted to encode for a secreted or membrane-bound protein. We also identified gly-5, a GalNAc transferase that initiates O-linked glycosylation. Overall, we describe the first C. elegans screen to identify host factors that control microbiome bacterial colonization in the gut.

genetics↗