Search bioRxivSearch

Biology subjects

Wadim J Kapulkin

Publications and source records attributed to Wadim J Kapulkin.

2 recordsLinked to original sources

Retroviral origins of the Caenorhabditis elegans orphan gene F58H7.5.

This work describes the results of the genome-scale analysis of endogenous retrovirus insertions in two C. elegans isolates: the prototype N2 (Bristol) and CB4856 (Hawaii). In total thirteen, identification of potentially replication competent, endogenous retroviral elements is described. Ten elements were identified as conserved between N2 and CB4856 by the reciprocal match of paired LTRs. The description focuses on the particular endogenous retrovirus insertion wich is identified on the proximal arm of the chromosome IV (located at positions IV: 912,948 - 921,658 and IV: 899,767 - 908,485 of the N2 and CB4856 respectively). In both isolates the inserted provirus is flanked by the predicted long terminal repeats (LTR)s of the length of 415 bp and of identical sequence. Provided the absolute LTR sequence identity this particular provirus represents insertion acquired prior to split from the common ancestor, suggesting this insertion event is evolutionary recent. The identified insertion of the endogenous retrovirus embeds the orphan gene F58H7.5, specific to C. elegans lineage. This unprecedented example establishes that in the evolutionary past C. elegans, had acquired the gene of the retroviral origins presumably via mechanisms involving the RNA intermediate.\n\nImportanceThis work describes the retroviral origins of C. elegans orphan gene F58H7.5. Presented work implies that in the evolutionary past the C. elegans have acquired new gene as a result of the infection event. C. elegans is presently regarded as genetic model organism widely used in genetic research. The genome of C. elegans have been sequenced nearly 20 years ago. This unprecedented example establishes that in the evolutionary past C. elegans genome, had acquired the gene of the retroviral origins presumably via mechanisms involving the RNA intermediate.

Genomics

Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans

This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PAM repeat region. We describe the allelic spectrum of mutational events identified at position specified by gRNA-unc-22-1000. Of above experiments we conclude: i. the trinucleotide (NGG)n PAM repeat is a receptive target for the CRISPR/Cas9 experiments in C. elegans ii. we conclude the allelic spectrum indicates the gRNA-unc-22-1000 induces fairly frequent NHEJ joining events involving deletions and indels but also, a phenotypically distinct class of small in-frame deletions indicative for microhomology-mediated end-joining (MMEJ) as a result of S. pyogenes Cas9 activity at the trinucleotide (NGG)n PAM repeat region. We demonstrate guide RNA-unc-22-1000 could be used to modify complex transgenic C. elegans line expressing human beta-amyloid protein. We provide the evidence for bi-allelic transaction resulting from Cas9 action recovered in experiment in CB1138 him-6 background. We contrast the expected performance of gRNA-unc-22-1000 with guide targeting another type of C. elegans repeat embedding S. pyogenes PAM, the telomeric repeat (TTAGGC)n. We propose that preferential frame restoring MMEJ repair of the Cas9 cut at the 'modules' encoding for poly-glycine in +2(NGG)n position could be useful mode of genome engineering at the naturally occurring (NGG)n PAM embedding repeats dispersed across animal genomes.

Genetics