Biology subjects

Magalska, A.

Publications and source records attributed to Magalska, A..

7 recordsLinked to original sources

bioRxiv2024

Arc/Arg3.1 binds the nuclear polyadenylate-binding protein RRM and regulates neuronal activity-dependent formation of nuclear speckles

Arc is a neuronal activity-induced protein interaction hub with critical roles in synaptic plasticity and memory. Arc localizes to synapses and the nucleus, but its nuclear functions are little known. We show that Arc accumulates in the interchromatin space of dentate granule cell nuclei and the nucleosol subcellular fraction following seizure activity and in vivo dentate gyrus LTP. Proteomic analysis of affinity-purified Arc complexes identified proteins with functions in post-transcriptional mRNA processing. During LTP, Arc undergoes enhanced complex formation with polyadenylate binding protein nuclear 1 (PABPN1) and paraspeckle splicing factor (PSF) in the nucleosol. In vitro peptide binding arrays show selective binding of Arc to the PABPN1 polyA RNA recognition motif. In hippocampal neuronal cultures, Arc knockdown increases formation of PABPN1 nuclear speckles and blocks chemical-LTP associated increases in small PABPN1 foci. These results implicate Arc in basal and neuronal activity-dependent regulation of PABPN1 speckles involved in mRNA processing and polyadenylation.

neuroscience↗

bioRxiv2024

Neuronal activation affects the organization and protein composition of the nuclear speckles

Nuclear speckles, also known as interchromatin granule clusters (IGCs), are subnuclear domains highly enriched in proteins involved in transcription and mRNA metabolism and, until recently, have been regarded primarily as their storage and modification hubs. However, several recent studies on non-neuronal cell types indicate that nuclear speckles may directly contribute to gene expression as some of the active genes have been shown to associate with these structures. Neuronal activity is one of the key transcriptional regulators and may lead to the rearrangement of some nuclear bodies. Notably, the impact of neuronal activation on IGC/nuclear speckles organization and function remains unexplored. To address this research gap, we examined whether and how neuronal stimulation affects the organization of these bodies in granular neurons from the rat hippocampal formation. Our findings demonstrate that neuronal stimulation induces morphological and proteomic remodelling of the nuclear speckles under both in vitro and in vivo conditions. Importantly, these changes are not associated with cellular stress or cell death but are dependent on transcription and splicing.

cell biology↗

bioRxiv2021

The nucleoporin Nup50 activates the Ran guanyl-nucleotide exchange factor RCC1 to promote mitotic NPC assembly

During mitotic exit, thousands of nuclear pore complexes (NPCs) assemble concomitant with the nuclear envelope to build a transport-competent nucleus. We show here that Nup50 plays a crucial role in NPC assembly that is independent of its well-established function in nuclear transport. RNAi-mediated downregulation in cells or immunodepletion of the protein in Xenopus egg extracts interferes with NPC assembly. We define a conserved central region of 46 residues in Nup50 that is crucial for Nup153 and MEL28/ELYS binding, and NPC interaction. Surprisingly, neither NPC interaction nor binding of Nup50 to importin , {beta}, the GTPase Ran or chromatin is crucial for its function in the assembly process. Instead, we discovered that an N-terminal fragment of Nup50 can stimulate the Ran guanine exchange factor RCC1 and NPC assembly, indicating that Nup50 acts via the Ran system in mitotic NPC reformation. In support of this conclusion, Nup50 mutants defective in RCC1 binding and stimulation cannot replace the wild type protein in in vitro NPC assembly assays.

cell biology↗

bioRxiv2020

An important role of the interplay between Bdnf transcription and histone acetylation in epileptogenesis

Brain-Derived Neurotrophic Factor is one of the most important trophic proteins in the brain. The role of this growth factor in neuronal plasticity, in health and disease, has been extensively studied. However, mechanisms of epigenetic regulation of Bdnf gene expression in epilepsy are still elusive. In our previous work, using a rat model of neuronal activation upon kainate-induced seizures, we observed a repositioning of Bdnf alleles from the nuclear periphery towards the nuclear center. This change of Bdnf intranuclear position was associated with transcriptional gene activity. In the present study, using the same neuronal activation model, we analyzed the relation between the percentage of the Bdnf allele at the nuclear periphery and clinical and morphological traits of epilepsy. We observed that the decrease of the percentage of the Bdnf allele at the nuclear periphery correlates with stronger mossy fiber sprouting - an aberrant form of excitatory circuits formation. Moreover, using in vitro hippocampal cultures we showed that Bdnf repositioning is a consequence of the transcriptional activity. Inhibition of RNA polymerase II activity in primary cultured neurons with Actinomycin D completely blocked Bdnf gene transcription and repositioning observed after neuronal excitation. Interestingly, we observed that histone deacetylases inhibition with Trichostatin A induced a slight increase of Bdnf gene transcription and its repositioning even in the absence of neuronal excitation. Presented results provide novel insight into the role of BDNF in epileptogenesis. Moreover, they strengthen the statement that this particular gene is a good candidate to search for a new generation of antiepileptic therapies.

neuroscience↗

bioRxiv2020

PartSeg, a Tool for Quantitative Feature Extraction From 3D Microscopy Images for Dummies

BackgroundBioimaging techniques offer a robust tool for studying molecular pathways and morphological phenotypes of cell populations subjected to various conditions. As modern high resolution 3D microscopy provides access to an ever-increasing amount of high quality images, there arises a need for their analysis in an automated, unbiased and simple way. Segmentation of structures within cell nucleus, which is the focus of this paper, presents a new layer of complexity in the form of dense packing and significant signal overlap. At the same time the available segmentation tools provide a steep learning curve for new users with limited technical background. This is especially apparent in bulk processing of image sets, which requires the use of some form of programming notation. ResultsIn this paper, we present PartSeg, a tool for segmentation and reconstruction of 3D microscopy images, optimised for the study of cell nucleus. PartSeg integrates refined versions of several state-of-the-art algorithms, including a new multi-scale approach for segmentation and quantitative analysis of 3D microscopy images. The features and user-friendly interface of PartSeg were carefully planned with biologists in mind, based on analysis of multiple use cases and difficulties encountered with other tools, to offer ergonomic interface with a minimal entry barrier. Bulk processing in an ad-hoc manner is possible without the need for programmer support. As the size of datasets of interest grows, such bulk processing solutions become essential for proper statistical analysis of results. Advanced users can use PartSeg components as a library within Python data processing and visualisation pipelines, for example within Jupyter notebooks. The tool is extensible so that new functionality and algorithms can be added by the use of plugins. For biologists the utility of PartSeg is presented in several scenarios, showing the quantitative analysis of nuclear structures. ConclusionsIn this paper, we have presented PartSeg which is a tool for precise and verifiable segmentation and reconstruction of 3D microscopy images. PartSeg is optimised for cell nucleus analysis and offers multiscale segmentation algorithms best-suited for this task. PartSeg can also be used for bulk processing of multiple images and its components can be reused in other systems or computational experiments. Contact g.bokota@cent.uw.edu.pl, a.magalska@nencki.edu.pl, d.plewczynski@cent.uw.edu.pl

bioinformatics↗

bioRxiv2020

Ultrastructural Visualization of 3D Chromatin Folding Using Serial Block-Face Scanning Electron Microscopy and In Situ Hybridization (3D-EMISH)

The human genome is extensively folded into 3-dimensional organization, yet the detailed 3D chromatin folding structures have not been fully visualized due to the lack of robust and ultra- resolution imaging capability. Here, we report the development of a novel electron microscopy method that combines serial block-face scanning electron microscopy with in situ hybridization (3D-EMISH) to visualize 3D chromatin folding at targeted genomic regions with ultra-resolution (5x5x30 nm in xyz dimensions, respectively). We applied 3D-EMISH to human lymphoblastoid cells at a 1.7 Mb segment of the genome and visualized a large number of distinctive 3D chromatin folding structures in high ultra-resolution. We further quantitatively characterized the reconstituted chromatin folding structures by identifying sub-domains, and uncovered a high level of heterogeneity in chromatin folding ultrastructures, suggestive of extensive dynamic fluidity in 3D chromatin states.

genomics↗

bioRxiv2016

Recombinant DNA resources for the comparative genomics of Ancylostoma ceylanicum.

We describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm, Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5 -linker - GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematode C. elegans and A. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organism C. elegans and closely related parasitic species. We discuss the potential and relevance of Ancylostoma ceylanicum data and resources generated by the recombinant DNA approach.

genomics↗