Biology subjects

Loke, S.

Publications and source records attributed to Loke, S..

9 recordsLinked to original sources

bioRxiv2026

Cohort-stratified prioritization of CRISPR-Cas9 sgRNAs for HDR-mediated correction of TP53 hotspot codons in cancer

TP53 is mutated in roughly half of all human cancers. Eight recurrent missense substitutions in the DNA-binding domain (R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R282W) account for most of the mutational burden. Homology-directed repair (HDR) with a wild-type donor template is one of the few feasible routes to revert these alleles, but existing CRISPR sgRNA design tools rank candidates without reference to the cancer cohort being treated. We built a reproducible pipeline that prioritizes SpCas9 sgRNAs for HDR-mediated correction of TP53 hotspot codons. The pipeline uses NM 000546.6 from NCBI, GRCh38 off-target search via Cas-OFFinder with the published Doench-2016 CFD matrices, on-target Doench-2016 (Rule Set 2) scores from CRISPOR, and per-cohort hotspot prevalence from three TCGA Pan-Cancer Atlas studies (HGSOC, n = 523; PDAC, n = 179; CRC, n = 534) accessed through cBioPortal. We enumerate guides whose cut sites fall within {+/-}10 nt of each hotspot codon, exclude any candidate that fails to map to GRCh38, and score the remainder. The final set contains 21 SpCas9 NGG sgRNAs across the seven hotspots, with no PAM-desert residues. A single candidate at R248 (TP53-248-P-ad878223; spacer GCATGGGCGGCATGAACCGG, AGG PAM; off-target specificity 0.913 over 806 reference-genome hits) ranks first in all three cohorts and holds rank 1 in 97% of 147 weight settings tested. Four additional residues (R175, Y220, R273, R282) yield within-residue tier-1 picks robust in 100% of weight settings. Cohort-specific differences appear only in cross-residue ordering: R175 and R282 climb in CRC, consistent with the higher prevalence of R175H and R282W in colorectal tumors.

bioinformatics↗

bioRxiv2025

Skeletal muscle mitochondria contain nuclear-encoded RNA species prior to and following adaptation to exercise training in rats

Skeletal muscle mitochondria adaptation to exercise training is mediated by molecular factors that are not fully understood. Mitochondria import over 1000 proteins encoded by the nuclear genome, but the RNA population resident within the organelle is generally thought to be exclusively encoded by the mitochondrial genome. However, recent in vitro evidence suggests that specific nuclear-encoded miRNAs and other non-coding RNAs (ncRNAs) can reside within the mitochondrial matrix. Whether these are present in mitochondria of skeletal muscle tissue, and if this affected by endurance training - a potent metabolic stimulus for mitochondrial adaptation - remains unknown. Rats underwent four weeks of moderate intensity treadmill exercise training, then humanely killed and tissues collected for molecular profiling. Mitochondria from gastrocnemius skeletal muscle were isolated by immunoprecipitation, further purified, then the resident RNA was sequenced to assess the mitochondrial transcriptome. Exercise training elicited typical transcriptomic responses and functional adaptations in skeletal muscle, including increased mitochondrial respiratory capacity. We identified 24 nuclear-encoded, coding or non-coding RNAs in purified mitochondria, in addition to 50 nuclear-encoded miRNAs that met a specified abundance threshold. Although none were differentially expressed in the exercise vs control group at FDR<0.05, exploratory analyses suggested that the abundance of 3 miRNAs were altered (p<0.05) in mitochondria isolated from trained compared with sedentary skeletal muscle. We report the presence of a specific population of nuclear-encoded RNAs in the mitochondria isolated from rat skeletal muscle tissue, which could play a role in regulating exercise adaptations and mitochondrial biology. KEY POINTSO_LIMitochondria are a central metabolic and signalling hub, particularly in tissues with high energy demand such as skeletal muscle. Their ability to adapt to stimuli such as exercise training is directly related to improved metabolic health. Understanding the factors that regulate these adaptive processes is therefore essential. C_LIO_LIMitochondria contain RNA encoded by their own genome (mtDNA); typically are not thought to contain nuclear-encoded RNA. C_LIO_LIHere, we report that mitochondria from rat skeletal muscle do indeed contain a select population of nuclear-encoded protein coding and non-coding RNAs, including 3 microRNAs whose expression tended to be altered by exercise training. C_LIO_LIThese findings suggest that mitochondria-localised nuclear-encoded RNAs may play a role in mediating beneficial adaptive responses to exercise. C_LI

physiology↗

bioRxiv2024

Mitochondria isolated from male skeletal muscle contain a distinct 1 population of miRNA that are differentially expressed following acute exercise

Initially thought to localise at the cytosol and nucleus only, emerging evidence indicates that miRNAs also localise within the mitochondria where they could regulate diverse pathological and physiological processes. Therefore, the aim of the current study was to use small RNA sequencing to profile and compare the entire population of miRNAs in human skeletal muscle of healthy males in whole-tissue and in isolated mitochondria at rest and in response to acute endurance exercise. Twelve healthy males (age 26 {+/-} 4 years, mean {+/-} SD) cycled for 60 min at 70% VO2peak and muscle biopsies were collected at rest, immediately after and 3 h after exercise. The mitochondria were isolated by immunoprecipitation, further purified, then the resident RNA was sequenced to assess the mitochondrial transcriptome. Small RNA sequencing revealed that mitochondria isolated from male skeletal muscle tissue contain a small and distinct population of miRNAs. Of the approximately 110 mature miRNAs detected in skeletal muscle mitochondria at each time-point, the canonical myo-miRs miR-1, miR-133 and miR-206 families constituted on average 45% of total mitochondria miRNA reads. However, none of these canonical myo-miRs were differentially expressed in mitochondria following endurance exercise. One miRNA, hsa-miR-146b-3p, was differentially expressed in both whole muscle tissue and mitochondria when adjusted for multiple testing (FDR <0.05). Future research is now required to investigate miRNA-mRNA interactions in the mitochondria of skeletal muscle tissue. KEY POINTS SUMMARYO_LIEmerging evidence suggests microRNA are localised in the mitochondria of skeletal muscle cells and may play a role in regulating mitochondrial function. C_LIO_LIWe recently optimised an approach to isolate RNA from mitochondria of human skeletal muscle that is free from contaminating cytosolic RNA and suitable for RNA sequencing. C_LIO_LIIn this study we examined the microRNA population from male skeletal muscle mitochondria before and in the hours following 60 minutes of moderate intensity cycling exercise. C_LIO_LIWe detected around 110 microRNAs in skeletal muscle mitochondria, with the muscle enriched myo-miR such as miR-1, miR-133 and miR-206 families constituting almost half of the reads. However, only one microRNA, hsa-miR-146b-3p, was differentially expressed whereby it increased [~] 10-fold following exercise. C_LIO_LIThe results provide new knowledge into how mitochondria might be regulated at the subcellular level and in response to physiological stressors such as exercise. C_LI

cell biology↗

bioRxiv2023

Transcriptional acclimation to warming temperatures of the Australian alpine herb Wahlenbergia ceracea

Understanding the molecular mechanisms of heat tolerance could help to predict the impacts of climate change on our native flora. However, much of our current understanding is derived from Arabidopsis thaliana and select crops exposed to short and intense periods of heat stress. Here, we characterise the transcriptomic response of Wahlenbergia ceracea, a perennial herb found in Australias subalpine regions, to sustained moderate warming. We contrasted responses between relatively heat-tolerant and heat-sensitive lines grown under cool (24/15 {o}C day/night) or warm (30/20 {o}C) temperatures. We observed that sustained warming up-regulated genes related to RNA regulation, including modification and splicing, and down-regulated genes associated with photosynthesis and plastid organization. Interestingly, heat-tolerant lines demonstrated a more pronounced repression of photosynthesis-associated genes, compared to heat-sensitive lines, suggesting that the regulation of the light-harvesting machinery may contribute to photosystem thermal tolerance. Co-expression analyses revealed only weak module-level correlations with direct measures of thermal tolerance. However, stronger associations were evident with chlorophyll content and photosynthetic efficiency, which might indirectly influence thermal tolerance. Prediction of transcription factors targeting warming-responsive genes implicated hormone signaling networks, especially ethylene, in contributing to differences in thermal tolerance. In conclusion, we present genomic resources for transcriptome analyses in W. ceracea and highlight the contrasting gene regulatory patterns between relatively heat-tolerant and heat-sensitive W. ceracea lines experiencing sustained moderate warming.

plant biology↗

bioRxiv2023

The genome of the Wollemi pine, a critically endangered living fossil unchanged since the Cretaceous, reveals extensive ancient transposon activity.

We present the genome of the living fossil, Wollemia nobilis, a southern hemisphere conifer morphologically unchanged since the Cretaceous. Presumed extinct until rediscovery in 1994, the Wollemi pine is critically endangered with less than 60 wild adults threatened by intensifying bushfires in the Blue Mountains of Australia. The 12 Gb genome is among the most contiguous large plant genomes assembled, with extremely low heterozygosity and unusual abundance of DNA transposons. Reduced representation and genome re-sequencing of individuals confirms a relictual population since the last major glacial/drying period in Australia, 120 ky BP. Small RNA and methylome sequencing reveal conservation of ancient silencing mechanisms despite the presence of thousands of active and abundant transposons, including some transferred horizontally to conifers from arthropods in the Jurassic. A retrotransposon burst 8-6 my BP coincided with population decline, possibly as an adaptation enhancing epigenetic diversity. Wollemia, like other conifers, is susceptible to Phytophthora, and a suite of defense genes, similar to those in loblolly pine, are targeted for silencing by sRNAs in leaves. The genome provides insight into the earliest seed plants, while enabling conservation efforts.

genomics↗

bioRxiv2022

Purification of mitochondria from skeletal muscle tissue for transcriptomic analyses reveals localisation of nuclear-encoded non-coding RNAs

Mitochondria are central to cellular function, particularly in metabolically active tissues such as skeletal muscle. Nuclear-encoded RNAs typically localise within the nucleus and cytosol but a small population may also translocate to subcellular compartments such as mitochondria. We aimed to investigate the nuclear-encoded RNAs that localise within the mitochondria of skeletal muscle cells and tissue. Intact mitochondria were isolated via immunoprecipitation (IP) followed by enzymatic treatments (RNase-A and proteinase-K) optimised to remove transcripts located exterior to mitochondria, making it amenable for high-throughput transcriptomic sequencing. Small-RNA sequencing libraries were successfully constructed from as little as 1.8 ng mitochondrial RNA input. Small-RNA sequencing of mitochondria from rat myoblasts revealed the enrichment of over 200 miRNAs. Whole-transcriptome RNA sequencing of enzymatically-purified mitochondria isolated by IP from skeletal muscle tissue showed a striking similarity in the degree of purity compared to mitoplast preparations which lack an outer mitochondrial membrane. In summary, we describe a novel, powerful sequencing approach applicable to animal and human tissues and cells that can facilitate the discovery of nuclear-encoded RNA transcripts localised within skeletal muscle mitochondria.

cell biology↗

bioRxiv2021

Controlled Administration of Dehydrochloromethyltestosterone in Humans: Urinary Excretion and Long-Term Detection of Metabolites for Anti-Doping Purpose

Dehydrochloromethyltestosterone (DHCMT) is an anabolic-androgenic steroid that was developed by Jenapharm in the 1960s and was marketed as Oral Turinabol(R). It is prohibited in sports at all times; nevertheless, there are several findings by anti-doping laboratories every year. New long-term metabolites have been proposed in 2011/12, which resulted in adverse analytical findings in retests of the Olympic games of 2008 and 2012. However, no controlled administration trial monitoring these long-term metabolites was reported until now. In this study, DHCMT (5 mg, p.o.) was administered to five healthy male volunteers and their urine samples were collected for a total of 60 days. The unconjugated and the glucuronidated fraction were analyzed separately by gas chromatography coupled to tandem mass spectrometry. The formation of the described long-term metabolites was verified, and their excretion monitored in detail. Due to interindividual differences there were several varieties in the excretion profiles among the volunteers. The metabolite M3, which has a fully reduced A-ring and modified D-ring structure, was identified by comparison with reference material as 4-chloro-17{beta}-hydroxymethyl-17-methyl-18-nor-5-androstan-13-en-3-ol. It was found to be suitable as long-term marker for the intake of DHCMT in four of the volunteers. In one of the volunteers, it was detectable for 45 days after single oral dose administration. However, in two of the volunteers M5 (already published as long-term metabolite in the 1990s) showed longer detection windows. In one volunteer M3 was undetectable but another metabolite, M2, was found as the longest detectable metabolite. The last sample clearly identified as positive was collected between 9.9 and 44.9 days. Furthermore, the metabolite epiM4 (partially reduced A-ring and a modified D-ring structure which is epimerized in position 17 compared to M3) was identified in the urine of all volunteers with the help of chemically synthesized reference as 4-chloro-17-hydroxymethyl-17{beta}-methyl-18-nor-androsta-4,13-dien-3{beta}-ol. It may serve as additional confirmatory metabolite. It is highly recommended to screen for all known metabolites in both fractions, glucuronidated and unconjugated, to improve identification of cheating athletes. This study also offers some deeper insights into the metabolism of DHCMT and of 17-methyl steroids in general.

pharmacology and toxicology↗

bioRxiv2020

First draft genome of the Labyrinthula genus, an opportunistic seagrass pathogen, reveals novel insight into marine protist phylogeny, ecology and CAZyme cell-wall degradation

Labyrinthula spp. are saprobic, marine protists that also act as opportunistic pathogens and are the causative agents of seagrass wasting disease (SWD). Despite the threat of local- and large-scale SWD outbreaks, there are currently gaps in our understanding of the drivers of SWD, particularly surrounding Labyrinthula virulence and ecology. Given these uncertainties, we investigated Labyrinthula from a novel genomic perspective by presenting the first draft genome and predicted proteome of a pathogenic isolate of Labyrinthula SR_Ha_C, generated from a hybrid assembly of Nanopore and Illumina sequences. Phylogenetic and cross-phyla comparisons revealed insights into the evolutionary history of Stramenopiles. Genome annotation showed evidence of glideosome-type machinery and an apicoplast protein typically found in protist pathogens and parasites. Proteins involved in Labyrinthulas actin-myosin mode of transport, as well as carbohydrate degradation were also prevalent. Further, CAZyme functional predictions revealed a repertoire of enzymes involved in breakdown of cell-wall and carbohydrate storage compounds common to seagrasses. The relatively low number of CAZymes annotated from the genome of Labyrinthula SR_Ha_C compared to other Labyrinthulea species may reflect the conservative annotation parameters, a specialised substrate affinity and the scarcity of characterised protist enzymes. Inherently, there is high probability for finding both unique and novel enzymes from Labyrinthula spp. This study provides resources for further exploration of Labyrinthula ecology and evolution, and will hopefully be the catalyst for new hypothesis-driven SWD research revealing more details of molecular interactions between Labyrinthula species and its host substrate.

genomics↗

bioRxiv2020

Suppression of pyramidal neuron G protein-gated inwardly rectifying K+ channel signaling impairs prelimbic cortical function and underlies stress-induced deficits in cognitive flexibility

BackgroundImbalance in prefrontal cortical (PFC) pyramidal neuron excitation:inhibition is thought to underlie symptomologies shared across stress-related disorders and neuropsychiatric disease, including dysregulation of emotion and cognitive function. G protein-gated inwardly rectifying K+ (GIRK/Kir3) channels mediate excitability of medial PFC pyramidal neurons, however the functional role of these channels in mPFC-dependent regulation of affect, cognition, and cortical dynamics is unknown. MethodsIn mice harboring a floxed version of the kcnj3 (Girk1) gene, we used a viral-cre approach to disrupt GIRK1-containing channel expression in pyramidal neurons within the prelimbic (PL) or infralimbic (IL) cortices. Additional studies used a novel model of chronic unpredictable stress (CUS) to determine the impact on PL GIRK-dependent signaling and cognitive function. ResultsIn males, loss of pyramidal GIRK-dependent signaling in the PL, but not IL, differentially impacted measures of affect and motivation, and impaired working memory and cognitive flexibility. CUS produced similar deficits in affect and cognition that paralleled a reduction in PL pyramidal GIRK-dependent signaling akin to viral approaches. Viral- and stress-induced behavioral deficits were rescued by systemic injection of a novel, GIRK1-selective agonist, ML-297. Unexpectedly, neither ablation of PL GIRK-dependent signaling or exposure to the CUS regimen impacted affect or cognition in female mice. ConclusionsGIRK-dependent signaling in male mice, but not females, is critical for maintaining optimal PL function and behavioral control. Disruption of this inhibition may underlie stress-related dysfunction of the PL and represent a therapeutic target for treating stress-induced deficits in affect regulation and impaired cognition that reduce quality of life.

neuroscience↗