Biology subjects

Kapulkin, W. J.

Publications and source records attributed to Kapulkin, W. J..

3 recordsLinked to original sources

bioRxiv2019

Caenorhabditis elegans model for admixed proteinopathy of Huntington’s and Alzheimer-type

Formation of proteinaceous deposits composed of abnormally aggregated proteins characterizes a range of pathological conditions. Proteinaceous inclusions detected in the neurodegenerative conditions such Huntingtons chorea (HD) and Alzheimers disease (AD) are often referred as pathognomic and regarded as causally implicated. Despite of differences in aetiology and underlying genetics, rare cases of combined HD and AD were reported and described as admixed proteinopathies. Mixed proteopathies are characterized by the co-occurrence of at least two types of abnormal aggregation-prone variants; pathological deposition of proteinaceous inclusions might however, affect different cell populations. Here, combining plaques derived from human {beta}-amyloid with mutant HTT-like polyglutamine inclusions in a cell-autonomous manner, we report on the Caenorhabditis elegans model for admixed proteinopathy of Alzheimers and Huntingtons type. We show both types of intracellular foci are formed in vivo: non-amyloidic extended polyglutamine derived inclusions and distinguish those from the presence of mature {beta}- amyloid fibers. We found that polyglutamines expanded above pathogenic threshold and {beta}-amyloid act synergistically to promote the progression of proteotoxicity in a temperature dependent manner. We further, implicate the hsp-1 (the predominant C. elegans chaperone interacting with ER-routed A{beta}42) modulate the proteotoxic insults observed in combined proteopathy model. Our results demonstrate how the in vivo model of admixed proteopathy could be utilized to probe for human pathogenic variants confined to the same cellular type. In that perspective expanded aggregation-prone polyglutamines appended with fluorescent proteins could be regarded as pathogenic probes useful in the proteotoxicity assays i.e. involving {beta}-amyloid and possibly other comparable models of disease-associated aggregation prone variants.We anticipate models of combined proteopathies will be informative regarding the underlying pathogenesis and provide the sensitized background for sophisticated screening. For example the combinatorial effects of multiple pathogenic aggregation-prone variants could be tested against mutant backgrounds and pharmacological compounds. Furthermore, we surmise the postulated synergistic actions might explain some of the overlaps in observed progression of clinical symptoms in HD and AD. We also formulate the conjecture regarding the polyQ containing proteins as a contributing factor in degenerative conditions associated with increased {beta}-amyloid formation and deposition.

neuroscience↗

bioRxiv2018

Multiple mutations acquired into canine RecQ-like helicases encoded by the aneuploid genome of transmissible sarcoma

Sticker sarcoma - a highly aneuploid, contagious neoplasm circulating in a domestic dog population - is broadly referred as a canine transmissible venereal tumour (CTVT). The karyotype of transmissible Sticker sarcoma appears as a collage of numerical and structural aberrations; the CTVT genome represents the generalized but stable neoplastic aneuploidy of monoclonal origins. Presented is an analysis of genetic events and variants underlying the aneuploid genomic structure of Sticker sarcoma described previously by Murchison et al. (2014) and Decker et al. (2015). Here we explored the above CTVT genomic compendia and mined the existing data - specifically looking for cases of convergence of multiple non-synonymous variants onto a single gene - the mutational patterns indicative for Knudsonian two-hit kinetics. A Table I is given, providing theoretical estimates of retaining the intact wild-type copy, expected as a function of a cumulative mutational convergence observed in unphased sequence consensus. We demonstrate that the two canine RecQ-like helicases: Bloom syndrome helicase and RECQL4, encoded by the aneuploid transmissible tumour, have accumulated a multitude of different mutations. Among the sets of most intensely mutated transmissible sarcoma genes, we also identified a canine FANCD2 - yet another previously unnoticed multiple-hit candidate factor. We discuss a possible role of mutated RecQ-like helicases and other cooperating factors, perceivably involved in the maintenance of the neoplastic aneuploidy. We suggest the proposed cooperative actions of CTVT RecQ-like DNA helicases could be relevant interpreting whether variants contributing to RecQ-dependent karyotypic traits, respond to selective pressures that preserve the aneuploid genomic structure of transmissible Sticker sarcoma.\n\nO_TBL View this table:\norg.highwire.dtl.DTLVardef@13a4d4org.highwire.dtl.DTLVardef@1aa8257org.highwire.dtl.DTLVardef@15354faorg.highwire.dtl.DTLVardef@1efecd7org.highwire.dtl.DTLVardef@a650aa_HPS_FORMAT_FIGEXP M_TBL O_FLOATNOTable I.C_FLOATNO O_TABLECAPTIONDefined as an absolute complement of the corresponding rates - the theoretical expectations - predict the second-hit candidates retain only 50% chance of attaining the out-of-phase trans-heterozygous Knudsonian inheritance model, while multiple-hit candidates retain out-of-phase likelihoods equal or greater than 75%. Conversely the chance of retaining of the intact wild-type allele - consistent with all-cis-heterozygous phase constellation - implicates the convergence of all variants onto a remaining allele, hence single haplotype variant phase.\n\nC_TABLECAPTION C_TBL

cancer biology↗

bioRxiv2016

Recombinant DNA resources for the comparative genomics of Ancylostoma ceylanicum.

We describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm, Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5 -linker - GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematode C. elegans and A. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organism C. elegans and closely related parasitic species. We discuss the potential and relevance of Ancylostoma ceylanicum data and resources generated by the recombinant DNA approach.

genomics↗