Biology subjects

Chakraborty, S.

Publications and source records attributed to Chakraborty, S..

At least 235 records · Page 13Linked to original sources

bioRxiv2019

High-quality chromosome-scale assembly of the walnut (Juglans regia L) reference genome

The release of the first reference genome of walnut (Juglans regia L.) enabled many achievements in the characterization of walnut genetic and functional variation. However, it is highly fragmented, preventing the integration of genetic, transcriptomic, and proteomic information to fully elucidate walnut biological processes. Here we report the new chromosome-scale assembly of the walnut reference genome (Chandler v2.0) obtained by combining Oxford Nanopore long-read sequencing with chromosome conformation capture (Hi-C) technology. Relative to the previous reference genome, the new assembly features an 84.4-fold increase in N50 size, and the full sequence of all 16 chromosomal pseudomolecules, nine of which present telomere sequences at both ends. Using full-length transcripts from single-molecule real-time sequencing, we predicted 40,491 gene models, with a mean gene length higher than the previous gene annotations. Most of the new protein-coding genes (90%) are full-length, which represents a significant improvement compared to Chandler v1.0 (only 48%). We then tested the potential impact of the new chromosome-level genome on different areas of walnut research. By studying the proteome changes occurring during catkin development, we observed that the virtual proteome obtained from Chandler v2.0 presents fewer artifacts than the previous reference genome, enabling the identification of a new potential pollen allergen in walnut. Also, the new chromosome-scale genome facilitates in-depth studies of intraspecies genetic diversity by revealing previously undetected autozygous regions in Chandler, likely resulting from inbreeding, and 195 genomic regions highly differentiated between Western and Eastern walnut cultivars. Overall, Chandler v2.0 is a valuable resource to understand and explore walnut biology better.

genomics↗

bioRxiv2019

CRISPR-Cas off-target detection using Oxford Nanopore sequencing - is the mitochondrial genome more vulnerable to off-targets?

Oxford Nanopore sequencing of DNA molecules is fast gaining popularity for generating longer reads, albeit with higher error rates, in much lesser time, and without the error introduced by PCR-amplification. Recently, CRISPR-Cas9 has been used to enrich genomic regions (nCATS [1]). This was applied on 10 genomic loci (median length=18kb). Here, using the sequencing data (Accid:PRJNA531320), it is shown that the same flow can be used to identify CRISPR-Cas9 off-target edits (OTE). OTEs are an important, but unfortunately underestimated, aspect of CRISPR-Cas gene-editing. An OTE in the mitochondrial genome is shown having 7 mismatches with one of the 10 gRNAs used (GPX1), having as much enrichment as the targeted genomic loci in some samples. Previous study has shown that Cas9 bind to off-targets having as many as 10 mismatches in the PAM-distal region. This OTE has not been reported in the original study (still a pre-print), which states that sequences from parts other than the target locations arise from ligation of nanopore adaptors to random breakage points, with no clear evidence of off-target cleavage by Cas9 [1], Furthermore, a lot of reads aligning to the mitochondrial genome (sometimes full length) are inverted after the edit. It remains to be seen if these are bona fide translocations after the Cas9 edit, or ONP sequencing artifacts. This also raises the question whether the mitochondrial genome is more prone to off-targets by virtue of being non-nuclear. Another locus in ChrX (13121412) has only 1 mismatch with the second BRAF gRNA (GACCAAGGATTTCGTGGTGA). Although the number of reads for this OTE is less, its very unlikely this is random since it happens 8 out of 11 samples. With the increasing use of (TALEN/ZFN/CRISPR-Cas9) on human subjects, this provides a fast method to quickly query gRNAs for off-targets in cells obtained from the patient, which will have their own unique off-targets due to single nucleotide polymorphism or other variants.

genomics↗

bioRxiv2019

Loss of tissue non-specific alkaline phosphatase (TNAP) enzyme activity in cerebral microvessels is coupled to persistent neuroinflammation and behavioral deficits in late sepsis

Sepsis is characterized as a host response to systemic inflammation and infection that may lead to multi-organ dysfunction and eventual death. While acute brain dysfunction is common among all sepsis patients, chronic neurological impairment is prevalent among sepsis survivors. The brain microvasculature has recently emerged as a major determinant of sepsis-associated brain dysfunction, yet the mechanisms that underlie its associated neuroimmune perturbations and behavioral deficits are not well understood. A growing body of data suggests that the loss of tissue nonspecific alkaline phosphatase (TNAP) enzyme activity in cerebral microvessels may be associated with changes in endothelial cell barrier integrity. The objective of this study was to determine the important mechanisms linking alterations in cerebrovascular TNAP enzyme activity to underlying neurological impairment in late sepsis. We hypothesized that the disruption of TNAP enzymatic activity in cerebral microvessels would be coupled to the sustained loss of brain microvascular integrity, elevated neuroinflammatory responses, and behavioral deficits. Male mice were subjected to cecal ligation and puncture (CLP), a model of experimental sepsis, and assessed up to seven days post-sepsis. All mice were observed daily for sickness behavior and underwent behavioral testing. Our results showed a significant decrease in brain microvascular TNAP enzyme activity in the somatosensory cortex and spinal cord of septic mice but not in the CA1 and CA3 hippocampal regions. Analyses of whole brain myeloid and T-lymphoid cell populations also revealed a persistent elevation of infiltrating leukocytes, which included both neutrophil and monocyte myeloid derived suppressor cells (MDSCs). Regional analyses of the somatosensory cortex, hippocampus, and spinal cord revealed significant astrogliosis and microgliosis in the cortex and spinal cord of septic mice that was accompanied by significant microgliosis in the CA1 and CA3 hippocampal regions. Assessment of behavioral deficits revealed no changes in learning and memory or evoked locomotion. However, the hot plate test uncovered a novel anti-nociceptive phenotype in our septic mice, and we speculate that this phenotype may be a consequence of sustained GFAP astrogliosis and loss of TNAP activity in the somatosensory cortex of septic mice. Taken together, these results demonstrate that the loss of TNAP enzyme activity in cerebral microvessels during late sepsis is coupled to sustained neuroimmune dysfunction which may underlie, in part, the chronic neurological impairments observed in sepsis survivors.\n\nHighlightsO_LIAlkaline phosphatase activity in brain microvessels is diminished in sepsis.\nC_LIO_LILoss of alkaline phosphatase activity is coupled to the loss of barrier integrity.\nC_LIO_LIBrain infiltration of myeloid and T-lymphoid cells persists in late sepsis.\nC_LIO_LISeptic mice exhibit a novel anti-nociceptive phenotype.\nC_LIO_LICortical astrogliosis and microgliosis persist in late sepsis.\nC_LI

neuroscience↗

bioRxiv2019

Contriving a chimeric polyvalent vaccine to prevent infections caused by Herpes Simplex Virus (Type-1 and Type-2): an exploratory immunoinformatic approach

Herpes simplex virus type 1 (HSV-1) and 2 (HSV-2) cause a variety of infections including oral-facial infections, genital herpes, herpes keratitis, cutaneous infection and so on. To date, FDA-approved licensed HSV vaccine is not available yet. Hence, the study was conducted to identify and characterize an effective epitope based polyvalent vaccine against both types of Herpes Simplex Virus through targeting six viral proteins. The selected proteins were retrieved from viralzone and assessed to design highly antigenic epitopes by binding analyses of the peptides with MHC class-I and class-II molecules, antigenicity screening, transmembrane topology screening, allergenicity and toxicity assessment, population coverage analysis and molecular docking approach. The final vaccine was constructed by the combination of top CTL, HTL and BCL epitopes from each protein along with suitable adjuvant and linkers. Physicochemical and secondary structure analysis, disulfide engineering, molecular dynamic simulation and codon adaptation were further employed to develop a unique multi-epitope peptide vaccine. Docking analysis of the refined vaccine structure with different MHC molecules and human immune TLR-2 receptor demonstrated higher interaction. Complexed structure of the modeled vaccine and TLR-2 showed minimal deformability at molecular level. Moreover, translational potency and microbial expression of the modeled vaccine was analyzed with pET28a(+) vector for E. coli strain strain K12. The study enabled design of a novel chimeric polyvalent vaccine to confer broad range immunity against both HSV serotypes. However, further wet lab based research using model animals are highly recommended to experimentally validate our findings.

bioinformatics↗

bioRxiv2019

Multifaceted genome-wide study identifies novel regulatory loci for body mass index in Indians

Obesity, a risk factor for various human diseases originates through complex interactions between genes and prevailing environment that varies across populations. Indians exhibit a unique obesity phenotype likely attributed by specific gene pool and environmental factors. Here, we present genome-wide association study (GWAS) of 7,259 Indians to understand the genetic architecture of body mass index (BMI) in the population. Our study revealed novel association of variants in BAI3 (rs6913677) and SLC22A11 (rs2078267) at GWAS significance, and of ZNF45 (rs8100011) with near GWAS significance. As genetic loci may dictate the phenotype through modulation of epigenetic processes, we overlapped discovered genetic signatures with DNA methylation patterns of 236 Indian individuals, and analyzed expression of the candidate genes using publicly available data. The variants in BAI3 and SLC22A11 were found to dictate methylation patterns at unique CpGs harboring critical cis- regulatory elements. Further, BAI3, SLC22A11 and ZNF45 variants were found to overlie repressive chromatin, active enhancer, and active chromatin regions, in that order, in human subcutaneous adipose tissue in ENCODE database. Besides, the identified genomic regions represented potential binding sites for key transcription factors implicated in obesity and/or metabolic disorders. Interestingly, rs8100011 (ZNF45) acted as a robust cis-expression quantitative trait locus (cis-eQTL) in subcutaneous adipose tissue in GTEx portal, and ZNF45 gene expression showed an inverse correlation with BMI in skeletal muscle of Indian subjects. Further, gene-based GWAS analysis revealed CPS1 and UPP2 as additional leads regulating BMI in Indians. Our study decodes potential genomic mechanisms underlying obesity phenotype in Indians.

genomics↗

bioRxiv2019

Novel strategy for treating neurotropic viral infections using hypolipidemic drug Atorvastatin

Chandipura virus (CHPV) and Japanese Encephalitis Virus (JEV) are known to infect neurons followed by their successful propagation. Increased incidences of central nervous system invasion by the abovementioned viruses have been reported in case of children and elderly thus culminating into severe neurological damage. Literature suggests induction of endoplasmic reticulum (ER)-stress related proteins upon CHPV and JEV infection which help promote viral reproduction. Since earlier studies underscore the pleotropic role of atorvastatin (AT) in neuroprotection against flaviviruses like Hepatitis C and dengue, it was hypothesized that AT might also act as a neuroprotective agent against RNA viruses like CHPV and JEV. AT-mediated antiviral activity was evaluated by assessing survivability of virus-infected mouse pups treated with the drug. Balb C mice were used for in vivo experiments. Neuro2A cell line was used as the model for in vitro experiments. Cells subjected to AT treatment were infected by CHPV and JEV followed by evaluation of ER stress-related and apoptosis-related proteins by immunoblotting technique and immunofluorescence microscopy. Interaction of host protein with viral genome was assessed by RNA-Co-IP. AT treatment exhibited significant anti-viral activity against CHPV and JEV infections via hnRNPC-dependent manner. Viral genome-hnRNPC interaction was found to be abrogated upon AT action. AT was also observed to reduce secretion of proinflammatory cytokines by the neurons in response to viral infection. Moreover, AT treatment was also demonstrated to reduce neuronal death by abrogating virus-induced miR-21 upregulation in hnRNPC-dependent fashion. This study thus suggests probable candidature of AT as antiviral against CHPV and JEV infections.

microbiology↗

bioRxiv2019

Distinct Regulaton of Bioenergetics and Translation by Gp I mGluRs and NMDARs

Neuronal activity is responsible for large energy consumption within the brain. However, the cellular mechanisms draining ATP upon the arrival of a stimulus are yet to be explored systematically at the post-synapse. Here we provide evidence that a significant fraction of ATP is consumed upon glutamate stimulation to energize the mGluR-induced protein synthesis. We find that both mGluR and NMDAR alter protein synthesis and ATP consumption with distinct kinetics at the synaptic-dendritic compartments. While mGluR activation leads to a rapid and sustained reduction in the neuronal ATP level, NMDAR activation has no immediate impact on the same. ATP consumption correlates inversely to the kinetics of protein synthesis for both the receptors. We observe a persistent elevation in protein synthesis within 5 minutes of mGluR activation and robust inhibition of the same within 2 minutes of NMDAR activation, assessed by the phosphorylation status of eEF2 and metabolic labeling. However, a delayed protein synthesis-dependent ATP expenditure ensues after 15 minutes of NMDAR activation. We identify a central role for AMPK in this correlation between protein synthesis and ATP consumption. AMPK is dephosphorylated and inhibited upon mGluR activation while it was rapidly phosphorylated upon NMDAR activation. Perturbing AMPK activity disrupts the receptor-specific modulations of eEF2 phosphorylation and protein synthesis. Therefore, our observations suggest that the glutamate receptors required modulating the AMPK-eEF2 signaling axis to alter neuronal protein synthesis and bioenergetics. Short SummaryStimulation of glutamate receptors induces robust protein synthesis within cortical neurons and consumes a significantly large fraction of cellular ATP. Glutamate receptors viz. mGlulR and NMDAR modulate AMPK-eEF2 signaling uniquely leading to the dynamic regulation of protein synthesis and bioenergetics. Key HighlightsO_LIProtein synthesis following glutamate receptor activation is responsible for the bulk of the activity-induced ATP consumption in cortical neurons. C_LIO_LImGluR and NMDAR regulate protein synthesis with distinct kinetics and dictate the subsequent impacts over neuronal ATP level. C_LIO_LIDynamic modulation of AMPK and eEF2 phosphorylation is key to create unique temporal features of receptor-specific protein synthesis and bioenergetics. C_LI

neuroscience↗

bioRxiv2018

A novel role for Cyclic Nucleotide-Gated Ion Channel 2 (DND1) in auxin signaling

Cyclic Nucleotide Gated Ion Channels (CNGCs) have been firmly established as Ca2+-conducting ion channels that regulate a wide variety of physiological responses in plants. CNGC2 has been implicated in plant immunity and Ca2+ signaling due to the autoimmune phenotypes exhibited by null mutants of CNGC2. However, cngc2 mutants display additional phenotypes that are unique among autoimmune mutants, suggesting that CNGC2 has functions beyond defense and generates distinct Ca2+ signals in response to different triggers. In this study we found that cngc2 mutants showed reduced gravitropism, consistent with a defect in auxin signaling. This was mirrored in the diminished auxin response detected by the auxin reporters DR5::GUS and DII-VENUS and in a strongly impaired auxin-induced Ca2+ response. Moreover, the cngc2 mutant exhibits higher levels of the endogenous auxin indole-3-acetic acid (IAA), indicating that excess auxin in cngc2 causes its pleiotropic phenotypes. These auxin signaling defects and the autoimmunity syndrome of cngc2 could be suppressed by loss-of-function mutations in the auxin biosynthesis gene YUCCA6 (YUC6), as determined by identification of the cngc2 suppressor mutant repressor of cngc2 (rdd1) as an allele of YUC6. A loss-of-function mutation in the upstream auxin biosynthesis gene TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA1, WEAK ETHYLENE INSENSITIVE8) also suppressed the cngc2 phenotypes, further supporting the tight relationship between CNGC2 and the TAA-YUC-dependent auxin biosynthesis pathway. Taking these results together, we propose that the Ca2+ signal generated by CNGC2 is a part of the negative feedback regulation of auxin homeostasis in which CNGC2 balances cellular auxin perception by influencing auxin biosynthesis.

plant biology↗

bioRxiv2018

Anemia Diagnosis on a Simple Paper-based Assay

In developing countries, the maternal and neonatal mortality rate is often affected by prenatal period anemia, a preventable and ubiquitous impairment attributed due to low hemoglobin (Hgb) concentration. We report the development of a simple, frugal (~ 0.02 $ per test), rapid and high fidelity paper-based colorimetric microfluidic device for point-of-care (POC) detection of anemia. We validate our findings with 32 blood samples collected from different patients covering a wide spectrum of anemia and subsequently, compare with standard pathological results measured using a hematology analyzer. POC based Hgb estimates are correlated with the pathological gold standard estimates of Hgb levels (r = 0.909), and the POC test method yielded similar sensitivity and specificity for detecting mild anemia (n = 8) (<11 g/dl) (sensitivity: 87.5%, specificity: 100 %) and for severe anemia (n = 3) (<7 g/dl) (sensitivity: 100 %, specificity: 100 %). The estimated Hgb levels are, within 1.5 g/dl from the pathological estimate, for 91 % of the blood samples. Results demonstrate the elevated efficacy and viability of this POC colorimetric diagnostic test, in comparison to the state-of-the-art complex and expensive diagnostic tests for anemia detection.

bioengineering↗

bioRxiv2018

The wheat Sr22, Sr33, Sr35 and Sr45 genes confer resistance against stem rust in barley

In the last 20 years, stem rust caused by the fungus Puccinia graminis f. sp. tritici (Pgt), has re-emerged as a major threat to wheat and barley cultivation in Africa and Europe. In contrast to wheat with 82 designated stem rust (Sr) resistance genes, barleys genetic variation for stem rust resistance is very narrow with only seven resistance genes genetically identified. Of these, only one locus consisting of two genes is effective against Ug99, a strain of Pgt which emerged in Uganda in 1999 and has since spread to much of East Africa and parts of the Middle East. The objective of this study was to assess the functionality, in barley, of cloned wheat Sr genes effective against Ug99. Sr22, Sr33, Sr35 and Sr45 were transformed into barley cv. Golden Promise using Agrobacterium-mediated transformation. All four genes were found to confer effective stem rust resistance. The barley transgenics remained susceptible to the barley leaf rust pathogen Puccinia hordei, indicating that the resistance conferred by these wheat Sr genes was specific for Pgt. Cloned Sr genes from wheat are therefore a potential source of resistance against wheat stem rust in barley.

plant biology↗

bioRxiv2018

Reverse transcriptase fused CRISPR-Cas1 locus with RNA-seq expression necessitates revisiting hypothesis on acquisition of antibiotic resistance genes in multidrug-resistant Enterococcus faecalis V583

The emergence of drug-resistance in Enterococcus faecalis V583 through acquisition of resistance genes has been correlated to the absence of CRISPR-loci. Here, the presence of a bona-fide CRISPR locus in E. faecalis V583 (Accid:NC_004668.1) at 2238156 with a single 20 nt repeat is demonstrated. The presence of a putative endonuclease Cas1 13538 nucleotides away from the repeat substantiates this claim. This Cas1 (628 aa) is highly homologous (Eval:5e-34) to a Cas1 from Pseudanabaena biceps (Accid:WP 009625648.1, 697 aa), which belongs to the enigmatic family of RT-CRISPR locus. Such significant similarity to a Cas protein, the presence of a topoisomerase, other DUF (domain of unknown function) proteins as is often seen in CRISPR loci, and other hypothetical proteins indicates that this is a bona-fide CRISPR locus. Further corroboration is provided by expression of both the repeat and the Cas1 gene in existing RNA-seq data (SRX3438611). Since so little is known of even well-studied species like E. faecalis V583 having many hypothetical proteins, computational absence of evidence should not be taken as evidence of absence (both crisprfinder and PILER-CR do not report this as a CRISPR locus). It is unlikely that bacteria would completely give up defense against its primeval enemies (viruses) to bolster its fight against the newly introduced antibiotics.

genomics↗

bioRxiv2018

An atypical CRISPR-Cas locus in Symbiobacterium thermophilum flanked by a transposase, a reverse transcriptase, the endonuclease MutS2 and a putative Cas9-like protein

Clustered regularly interspaced short palindromic repeats (CRISPR) is a prokaryotic adaptive defense system that assimilates short sequences of invading genomes (spacers) within repeats, and uses nearby effector proteins (Cas), one of which is an endonuclease (Cas9), to cleave homologous nucleic acid during future infections from the same or closely related organisms. Here, a novel CRISPR locus with uncharacterized Cas proteins, is reported in Symbiobacterium thermophilum (Accid:NC 006177.1) around loc.1248561. Credence to this assertion is provided by four arguments. First, the presence of an exact repeat (CACGTGGGGTTCGGGTCGGACTG, 23 nucleotides) occurs eight times encompassing fragments about 83 nucleotides long. Second, comparison to a known CRISPR-Cas locus in the same organism (loc.355482) with an endonuclease Cas3 (WP 011194444.1, 729 aa) [~]10000 nt upstream shows the presence of a known MutS2 endonuclease (WP 011195247.1, 801 aa) in approximately the same distance in loc.1248561. Thirdly, and remarkably, an uncharacterized protein (1357 aa) long is uncannily close in length to known Cas9 proteins (1368 for Streptococcus pyogenes). Lastly, the presence of transposases and reverse transcriptase (RT) downstream of the repeat indicates this is one of an enigmatic RT-CRISPR locus, Also, the MutS2 endonuclease is not characterized as a CRISPR-endonuclease to the best of my knowledge. Interestingly, this locus was not among the four loci (three confirmed, one probable) reported by crisperfinder (http://crispr.i2bc.paris-saclay.fr/Server), indicating that the search algorithm needs to be revisited. This finding begs the question - how many such CRISPR-Cas loci and Cas9-like proteins lie undiscovered within bacterial genomes?

genomics↗

bioRxiv2017

Detection and accurate False Discovery Rate control of differentially methylated regions from Whole Genome Bisulfite Sequencing

With recent advances in sequencing technology, it is now feasible to measure DNA methylation at tens of millions of sites across the entire genome. In most applications, biologists are interested in detecting differentially methylated regions, composed of multiple sites with differing methylation levels among populations. However, current computational approaches for detecting such regions do not provide accurate statistical inference. A major challenge in reporting uncertainty is that a genome-wide scan is involved in detecting these regions, which needs to be accounted for. A further challenge is that sample sizes are limited due to the costs associated with the technology. We have developed a new approach that overcomes these challenges and assesses uncertainty for differentially methylated regions in a rigorous manner. Region-level statistics are obtained by fitting a generalized least squares (GLS) regression model with a nested autoregressive correlated error structure for the effect of interest on transformed methylation proportions. We develop an inferential approach, based on a pooled null distribution, that can be implemented even when as few as two samples per population are available. Here we demonstrate the advantages of our method using both experimental data and Monte Carlo simulation. We find that the new method improves the specificity and sensitivity of list of regions and accurately controls the False Discovery Rate (FDR).

genomics↗

bioRxiv2017

Ambiguous specification of EGFR mutations compounded by nil or negligible fragmented gene counts and erroneous application of the Kappa statistic reiterates doubts on the veracity of the TEP-study

Final amendment noteThis paper had raised two issues - the error-prone classification and mistaken application of the Kappa statistic. The classification critique still holds, and is being taken up with other criticisms at http://www.biorxiv.org/content/early/2017/07/02/146134. The Kappa statistic was an error on my part since I had failed to see another page in Table S1. Please consider this pre-print closed.\n\nOriginal abstractThe use of RNA-seq from tumor-educated platelets (TEP) as a liquid biopsy source [1] has been refuted recently (http://biorxiv.org/content/early/2017/06/05/146134, not peer-reviewed). The TEP-study also mentioned that mutant epidermal growth factor receptor (EGFR) was accurately distinguished using surrogate TEP mRNA profiles, which is contested here. It is shown that only 10 out of 24 (a smaller sample set, original study has 60) non-small cell lung carcinoma (NSCLC) samples here has any expression at all. Even there the number of reads (101 bp) are [1, 4, 1, 14, 9, 1, 2, 19, 21, 6], and do not even add up to one complete EGFR gene (about 6000 bp). EGFR mutations have been painstakingly collated in www.mycancergenome.org/content/disease/lung-cancer/egfr. In stark contrast, the TEP study has no specification of the EGFR mutant used. The TEP study found EGFR mutations in 17/21 (81%), and EGFR wild-type in 4/39 (10%) for NSCLC samples (Table S7, reflected in Fig 3, Panel E in percentages). A major flaw is the assumption that a non \"EGFR wild-type\" is a \"EGFR mutant\" since cases zero with EGFR reads (which are almost half of the samples) could be either. The application of the Kappa statistic to this data is erroneous for two reasons. First, the Kappa statistic does not handle \"unknowns\", as is the case for samples with zero expression. Secondly, interobserver variation can be measured in any situation in which two or more independent observers are evaluating the same thing [2]. The 90% (Fig 3, Panel E) is just the percentage of samples (35/39) that are not \"EGFT WT\" in one observation. It is not qualified to be in the Kappa matrix, where it translates to 35, leading to a Kappa=0.707, which implies \"substantial agreement\" [2]. The other observation (looking for EGFR mutation) is in a different set. To summarize, this work reiterates negligible expression of EGFR reads in NSCLC samples, and finds serious shortcomings in the statistical analysis of subsequent mutational analysis from these reads in the TEP-study.

genomics↗

bioRxiv2017

A plausible explanation for in silico reporting of erroneous MET gene expression in tumor-educated platelets (TEP) intended for "liquid biopsy" of non-small cell lung carcinoma still refutes the TEP-study

Final amendment noteThis paper had proposed a plausible way for detecting large quantities of MET, which the authors have clarified was not done :the possible explanation proposed for this erroneous MET gene expression does bypass the filtering step we perform in the data processing pipeline, i.e. selection of intron-spanning reads, as can be read in the main text\" comments in http://www.biorxiv.org/content/early/2017/07/02/146134, where a continuing critique of the TEP study continues. Please consider this pre-print closed.\n\nOriginal abstractThe reported over-expression of MET genes in non-small cell lung carcinoma (NSCLC) from an analysis of the RNA-seq data from tumor-educated platelets (TEP), intended to supplement existing liquid biopsy techniques [1], has been refuted recently (http://biorxiv.org/content/early/2017/06/05/146134, not peer-reviewed). The MET proto-oncogene (Accid:NG 008996.1, RefSeqGene LRG 662 on chromosome 7, METwithintrons) encodes 21 exons resulting in a 6710 bps MET gene (Accid: NM 001127500.2, METonlyexons). METwithintrons has multiple matches in the RNA-seq derived reads of lung cancer samples (for example: SRR1982756.11853382). Unfortunately, these are non-specific sequences in the intronic regions, matching to multiple genes on different chromosomes with 100% identity (KIF6 on chr6, COL6A6 on chr3, MYO16 on chr13, etc. for SRR1982756.11853382). In contrast, METonlyexons has few matches in the reads, if at all [2]. However, even RNA-seq from healthy donors have similar matches for METwithintrons so the computation behind the over-expression statistic remains obscure, even if METwithintrons was used as the search gene. In summary, this work re-iterates the lack of reproducibility in the bioinformatic analysis that establishes TEP as a possible source for \"liquid biopsy\".

genomics↗

bioRxiv2017

No evidence of MET and HER2 over-expression in non-small cell lung carcinoma and breast cancer, respectively, raises serious doubts on using RNA-seq profiles of tumor-educated platelets as a ‘liquid biopsy’ source

In this detailed critique of the study proposing using RNA-seq from tumor-educated platelets (TEP) as a liquid biopsy source [1], several flawed assumptions leave little biological basis behind the statistical computations. First, there is no supporting evidence provided for the FFPE based classification of METoverexpression and EGFR mutation on tumor-tissues. Considering that raw reads of MET expression in a subset of healthy [N=21, mean=112, sd=77] and NSCLC [N=24, mean=11, sd=12] samples (typically with millions of reads) translates into over-expression in reality, providing the data for such computations is vital for future validation. A similar criticism applies for classifying samples based on EGFR mutations (the study uses only exon 20 and 21 from a wide range of possible mutations) with negligible counts [N=24, mean=3, sd=6]. While Ofner et. al, 2017 faced major problems associated with FFPE DNA, it is also true that Fassunke, et al., 2015 found concordance in 26 out of 26 samples for EGFR mutations in another FFPE-based study. However, Fassunke, et al., 2015 have been meticulous in describing the EGFR amplicons (exon 18 and 19 are missing in the TEP-study). Any error in initial classification renders downstream computations error-prone. The low counts of MET in the RNA-seq firmly establishes that inclusion of genes with such low counts in the set of 1100 discriminatory genes (Table S4) makes no sense as the \"real\" counts could vary wildly. Yet, TRAT1 is an example of one discriminator gene with counts of healthy [N=21, mean=164, sd=375] and NSCLC [N=24, mean=53, sd=176]. There are many such genes which should be excluded. Moving on to a discriminator with high counts (F13A1) in both healthy [N=21, mean=28228, sd=48581] and NSCLC [N=24, mean=98336, sd=74574] samples, a bonafide platelet gene that \"encodes the coagulation factor XIII A subunit\". Platelets do not have a nucleus, and thus the blue-print (chromosomes and related machinery) for making or regulating mRNA. They are boot-strapped with mRNA, like F13A1, during origination and then just go on keep collecting mRNA during circulation (which is the premise of their use in liquid biopsy). The assumption that these genes are differentially spliced in huge numbers is highly speculative without providing experimental proof. The discovery of spliceosomes in anucleate platelets [2] in 2005, 30 years after splicing was discovered in the nucleus by Sharp and Robert, probably indicates that spliceosomes are not dominant in platelets. Zucker, et al., 2017 have shown for another gene F11 that it is present in platelets as pre-mRNA and is spliced upon platelet activation [3]. Any study using the F13A1 gene as a discriminator ought to show the same two things, followed by differential counts in TEP. Ironically, F11 is not present in the discriminator set. Another blood coagulation related gene (TFPI) shows slight over-expression in NSCLC (moderate counts, healthy [N=21, mean=1352, sd=592] and NSCLC [N=24, mean=1854, sd=846]), agreeing with Iversen, et al., 1998 [4], but in contrast to Fei, et al., 2017 [5], demonstrating that the jury is still out on the levels of many such genes. Thus, circulating mRNA from tumor tissues are not discriminatoryif MET is degraded to such levels in platelets educated by NSCLC tumors, why not other possible mRNA that might have been picked during the same class? Furthermore, high count genes can only be bona-fide platelet genes, and have no supporting experimental proof of splicing differences (any one gene would suffice to instill some confidence). In conclusion, looking past the statistical smoke surrounding \"surrogate signatures\", one finds no biological relevance.

cancer biology↗

bioRxiv2017

Cataloguing Over-Expressed Genes In Epstein Barr Virus Immortalized Lymphoblastoid Cell Lines Through Consensus Analysis Of PacBio Transcriptomes Corroborates Hypomethylation Of Chromosome 1

The ability of Epstein Barr Virus (EBV) to transform resting cell B-cells into immortalized lymphoblastoid cell lines (LCL) provides a continuous source of peripheral blood lymphocytes that are used to model conditions in which these lymphocytes play a key role. Here, the PacBio generated transcriptome of three LCLs from a parent-daughter trio (SRAid:SRP036136) provided by a previous study [1] were analyzed using a kmer-based version of YeATS (KEATS). The set of over-expressed genes in these cell lines were determined based on a comparison with the PacBio transcriptome of twenty tissues provided by another study (hOPTRS) [2]. MIR155 long non-coding RNA (MIR155HG), Fc fragment of IgE receptor II (FCER2), T-cell leukemia/lymphoma 1A (TCL1A), and germinal center associated signaling and motility (GCSAM) were genes having the highest expression counts in the three LCLs with no expression in hOPTRS. Other over-expressed genes, having low expression in hOPTRS, were membrane spanning 4-domains A1 (MS4A1) and ribosomal protein S2 pseudogene 55 (RPS2P55). While some of these genes are known to be over-expressed in LCLs, this study provides a comprehensive cataloguing of such genes. A recent work involving a patient with EBV-positive large B-cell lymphoma was unusually lacking various B-cell markers, but over-expressing CD30 [3] - a gene ranked 79 among uniquely expressed genes here. Hypomethylation of chromosome 1 observed in EBV immortalized LCLs [4, 5] is also corroborated here by mapping the genes to chromosomes. Extending previous work identifying un-annotated genes [6], 80 genes were identified which are expressed in the three LCLs, not in hOPTRS, and missing in the GENCODE, RefSeq and RefSeqGene databases. KEATS introduces a method of determining expression counts based on a partitioning of the known annotated genes, has runtimes of a few hours on a personal workstation and provides detailed reports enabling proper debugging.

genomics↗

bioRxiv2017

Shorter unreported sequences in a RACE-Seq study involving seven tissues confirms ~150 novel transcripts identified in MCF-7 cell line PacBio transcriptome, leaving ~100 non-redundant transcripts exclusive to the cancer cell line

PacBio sequencing generates much longer reads compared to second-generation sequencing technologies, with a trade-off of lower throughput, higher error rate and more cost per base. The PacBio transcriptome of the breast cancer cell line MCF-7 was found to have [~]300 transcripts un-annotated in the current GENCODE (v25) or RefSeq, and missing in the liver, heart and brain PacBio transcriptomes [1]. RACE-sequencing (RACE-seq [2]) extends a well-established method of characterizing cDNA molecules generated by rapid amplification of cDNA ends (RACE [3]) using high-throughput sequencing technologies, reducing costs compared to PacBio. Here, shorter fragments of [~]150 transcripts were found to be present in seven tissues analyzed in a recent RACE-seq study (Accid:ERP012249) [4]. These transcripts were not among the [~]2500 novel transcripts reported in that study, tested separately here using the genomic coordinates provided, although all curated novel isoforms were incorporated into the human GENCODE set (v22) in that study. Non-redundancy analysis of the exclusive transcripts identified one transcript mapping to Chr1 with seven different splice variants, and erroneously mapped to Chr15 (PAC clone 15q11-q13) from the Prader-Willi/Angelman Syndrome region (Accid:AC004137.1). Finally, there are [~]100 non-redundant transcripts missing in the seven tissues, in addition to other three tissues analyzed previously. Their absence in GENCODE and RefSeq databases rule them out as commonly transcribed regions, further increasing their likelihood as biomarkers.

genomics↗