Search bioRxivSearch

Biology subjects

Bu, W.

Publications and source records attributed to Bu, W..

2 recordsLinked to original sources

Using pan RNA-seq analysis to reveal the ubiquitous existence of 5′ end and 3′ end small RNAs

In this study, we used pan RNA-seq analysis to reveal the ubiquitous existence of 5 end and 3 end small RNAs. 5 and 3 sRNAs alone can be used to annotate mitochondrial with 1-bp resolution and nuclear non-coding genes and identify new steady-state RNAs, which are usually from functional genes. Using 5, 3 and intronic sRNAs, we revealed that the enzymatic dsRNA cleavage and RNAi could involve in the RNA degradation and gene expression regulation of U1 snRNA in human. The further study of 5, 3 and intronic sRNAs help rediscover double-stranded RNA (dsRNA) cleavage, RNA interference (RNAi) and the regulation of gene expression, which challenges the classical theories. In this study, we provided a simple and cost effective way for the annotation of mitochondrial and nuclear non-coding genes and the identification of new steady-state RNAs, particularly long non-coding RNAs (lncRNAs). We also provided a different point of view for cancer and virus, based on the new discoveries of dsRNA cleavage, RNAi and the regulation of gene expression.

bioinformatics

Complemented palindrome small RNAs first discovered from SARS coronavirus

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

genomics