Biology subjects

Bu, W.

Publications and source records attributed to Bu, W..

17 recordsLinked to original sources

bioRxiv2026

Reconstructing sequence-grammar trajectories enables interpretable and tunable cis- regulatory element design

Designing synthetic cis-regulatory elements (CREs) with cell-type-specific activity remains challenging, and optimization is usually treated as a black box, obscuring how regulatory grammar emerges and why design trajectories fail. Here, we present GO-CRE (Guided Optimization of Cis-Regulatory Elements), which combines efficient sequence generation, predictor-guided reinforcement learning, and trajectory-level interpretation. GO-CRE reconstructs iterative sequence changes in a shared sequence-grammar landscape and identifies coordinated update programs corresponding to search, commitment, and optimization. Productive trajectories in HepG2 and K562 progressively acquired cell-type-associated grammar, whereas SK-N-SH trajectories remained confined to local basins. In HepG2, trajectory analysis revealed a low-complexity polyG trap; introducing a polyG penalty redirected optimization toward HNF/FOXA-associated features. Final designs retained sequence diversity while converging on cell-type-associated motif patterns. Lentiviral MPRA validated cell-type-specific activity in K562 and HepG2 and showed higher average activity of HepG2 designs than endogenous CREs. Together, these findings establish sequence-grammar trajectory reconstruction as a basis for interpretable and tunable synthetic CRE design.

genomics↗

bioRxiv2026

Phylogenetic Mosaic of an Arms Race with Asymmetrical Sexual Conflict and Its Macroevolutionary Consequences in a Lineage of Small Water Striders

Sexual conflict has been hypothesized as a driver of speciation, though its effects are likely heterogeneous across phylogenies and between sexes. The Gerromorpha (semi-aquatic bugs), which inhabits water surfaces across diverse aquatic environments, long served as a model for studying sexual conflict. While previous studies have focused on rapid antagonistic coevolution and the genetic basis of sexually antagonistic traits, the macroevolutionary consequences of asymmetrical sexual conflict-particularly male-dominated grasping traits versus female resistance-remain largely unexplored. Within the subgenus Pseudovelia, males exhibit pronounced phenotypic diversification in grasping structures, whereas females show modest, clade-specific resistance traits, suggesting male-biased asymmetric conflict. This system presents a valuable opportunity to examine how sexual conflict influences diversification and asymmetrical trait evolution across lineages. Using 204 individuals, representing over half of the subgenus's species diversity, we reconstructed a time-calibrated phylogeny, quantified diversification rates, assessed sexual conflict intensity across clades, and analyzed correlations between sexual trait evolution and diversification. Our results reveal extensive phylogenetic conflict, particularly within the East Asian clade, driven by introgression and incomplete lineage sorting (ILS). Furthermore, we observe significant phylogenetic heterogeneity in both phenotypic evolution and diversification rates. Notably, a male "trait package" enhancing grasping ability likely drives rapid diversification in the recently radiated "South China" lineage. In contrast, grasping traits involving abdominal segment VIII are associated with lower conflict intensity, facilitating greater evolutionary flexibility in female resistance and resulting in lineage-specific counter-adaptations. These findings highlight the heterogeneous dynamics of asymmetrical sexual conflict in shaping diversification and speciation.

evolutionary biology↗

bioRxiv2026

Immunization With Herpes Simplex Virus Nanoparticles Targeting Both Attachment and Fusion Protect Against Infection

Herpes simplex virus 2 (HSV-2) is associated with genital ulcers, neonatal encephalitis, increased risk of HIV infection, and dementia. There is no licensed HSV-2 vaccine. We developed nanoparticles displaying the HSV-2 attachment protein gD and fusion mediation protein complex gH/gL. Immunization of mice and non-human primates elicited high levels of neutralizing antibodies. Vaccination conferred robust protection in mice, preventing disease and nearly eliminating infection and shedding following HSV-2 challenge. While gD induced high neutralizing antibody titers, gH/gL contributed substantially to protection despite lower neutralization titers. Instead, gH/gL immunization generated strong fusion-blocking responses which were an important correlate of protection, showing that standard neutralization assays incompletely capture the importance of fusion-blocking activity. These findings demonstrate that targeting both HSV-2 attachment and fusion elicit complementary mechanisms for protection from infection and that neutralizing antibody alone may be insufficient for protection. Overall, these results present an innovative strategy for an HSV-2 vaccine.

immunology↗

bioRxiv2025

A BCG toxic effector induces mitochondrial DNA compaction to refrain protective immunity

Innate immune memory typically emphasizes nuclear chromatin remodeling that determines transcriptional memory in monocytes and macrophages. Here, we show that compaction of mitochondrial DNA (mtDNA), governed by mitochondrial transcription factor A (TFAM) abundance and mtATP-dependent remodeling, defines the transcriptional and functional state of trained macrophages. While typical pathogen-associated molecular pattern (PAMPs) triggered mtDNA accessibility, Bacillus Calmette-Guerin (BCG) effector PE18 directly interacted with and activated SLC25A5 to reduce mtATP levels, thereby inhibiting TFAM degradation by AFG3L2. Accumulated TFAM restricts mtDNA accessibility, suppressing the transcription of the mtNd1 and thereby reducing mtNd1-mediated mtROS production, which diminishes the trained capacity of macrophages against secondary infections. Notably, BCG{Delta}pe18 maintains macrophages cytokine transcriptional capacity independent of classical nuclear histone modifications. Moreover, BCG{Delta}pe18 provides robust and lifelong protective immunity against Mycobacterium tuberculosis (Mtb) infection. These findings reveal mitochondrial genome as a regulatory entity in trained immunity, and suggest a potential strategy for improving vaccine performance.

immunology↗

bioRxiv2025

Rat somatic genome editing enables ER+ breast cancer modeling

Genetically engineered mouse models have advanced cancer research but often fail to capture key features of certain human tumors. Rats, with distinct physiology and tumor biology, offer a powerful alternative, yet their use has been constrained by technical barriers to genome editing. Here, we report efficient somatic genome editing in rats, enabling both Indel and substitution mutations. We then apply this approach to model estrogen receptor (ER)-positive breast cancer, which accounts for [~]70% of human cases but remains poorly represented in mice. The resulting rat tumors reproduce hallmarks of human ER+ breast cancer, including ductal histology, hormone responsiveness, and immune-microenvironmental features. By contrast, identical genetic alterations in mice failed to yield ER+ tumors, underscoring critical species differences in tumorigenesis. Together, this work establishes a versatile platform for rapid generation of clinically relevant rat tumor models, opening new avenues to dissect tumor biology, therapeutic response, and immune interactions in previously inaccessible cancer subtypes.

cancer biology↗

bioRxiv2025

Formyl-peptide receptor type 2 activation mitigates secondary organ damage in inflammatory arthritis

Rheumatoid arthritis (RA) is associated with heart and lung dysfunction. Current therapies fail to attenuate such complications. Here, we identify formyl-peptide receptor type 2 (FPR2) as therapeutic target to treat heart and lung dysfunction associated with inflammatory arthritis. Arthritic mice on high levels of dietary homocysteine develop cardiac diastolic dysfunction and reduced lung compliance, mirroring two comorbidities in RA. Therapeutic administration of a small molecule FPR2 agonist (BMS986235) to hyper-homocysteine arthritic mice prevented diastolic dysfunction (monitored by echocardiography) and restored lung compliance. These tissue-specific effects were secondary to reduced neutrophil infiltration, modulation of fibroblast activation and phenotype (in the heart) and attenuation of monocyte and macrophage numbers (in the lung). A dual FPR1/2 agonist (compound 43) failed to prevent the reduction in lung compliance of arthritic mice and promoted accumulation of inflammatory monocytes and pro-fibrotic macrophages in lung parenchyma. This cellular response lies downstream of FPR1-mediated potentiation of CCL2-dependent monocyte chemotaxis and activation. This finding supports therapeutic development of selective FPR2 agonists to mitigate two impactful comorbidities associated with inflammatory arthritides.

pharmacology and toxicology↗

bioRxiv2024

Biomass allocation of trees in response to mono- and heterospecific neighbourhoods

Carbon sequestration by trees is crucial to mitigate the effects of the current climate crisis. The extent to trees sequester and allocate carbon to above- or belowground structures in turn is mediated by neighbouring species. Although many studies have demonstrated positive effects of diverse neighbourhoods on a trees productivity, little is known about biomass allocation responses to mono-vs. heterospecific neighbourhoods. In the present study we quantified above- and belowground biomass production and root-to-shoot ratios (RSR) of trees grown in mono- and heterospecific neighbourhoods. To this end we analysed growth of mono- and heterospecific tree species pairs (TSPs) established in a greenhouse and a field experiment. In the greenhouse experiment response variables were measured after one year of growth after sapling harvest. In the field experiment, conducted in the context of a forest biodiversity experiment in subtropical China, we analysed biomass density and RSR over three years using terrestrial laser scanner and minirhizotrons. RSR of trees in heterospecific TSPs were significantly higher than in monospecific TSPs. In the greenhouse experiment, this was related to a stronger below-than aboveground overyielding in heterospecific TSPs. In the field experiment, trees in heterospecific TSPs showed a stronger increase in aboveground investments over time than in monospecific TSPs, indicating that positive diversity effects became stronger for aboveground structures with progressing tree development. Our findings are consistent with the optimal biomass partitioning theory and highlight the importance of tree-tree interactions on biomass allocation. Higher RSR in mixtures further suggest a higher resistance or resilience of tree saplings against environmental stressors related to climate change (drought, heat waves).

ecology↗

bioRxiv2024

Propofol directly binds and inhibits skeletal muscle ryanodine receptor 1 (RyR1)

As the primary Ca2+ release channel in skeletal muscle sarcoplasmic reticulum (SR), mutations in the type 1 ryanodine receptor (RyR1) or its binding partners underlie a constellation of muscle disorders, including malignant hyperthermia (MH). In patients with MH mutations, exposure to triggering drugs such as the halogenated volatile anesthetics biases RyR1 to an open state, resulting in uncontrolled Ca2+ release, sarcomere tension and heat production. Restoration of Ca2+ into the SR also consumes ATP, generating a further untenable metabolic load. When anesthetizing patients with known MH mutations, the non-triggering intravenous general anesthetic propofol is commonly substituted for triggering anesthetics. Evidence of direct binding of anesthetic agents to RyR1 or its binding partners is scant, and the atomic-level interactions of propofol with RyR1 are entirely unknown. Here, we show that propofol decreases RyR1 opening in heavy SR vesicles and planar lipid bilayers, and that it inhibits activator-induced Ca2+ release from SR in human skeletal muscle. In addition to confirming direct binding, photoaffinity labeling using m-azipropofol (AziPm) revealed several putative propofol binding sites on RyR1. Prediction of binding affinity by molecular dynamics simulation suggests that propofol binds at least one of these sites at clinical concentrations. These findings invite the hypothesis that in addition to propofol not triggering MH, it may also be protective against MH by inhibiting induced Ca2+ flux through RyR1.

pharmacology and toxicology↗

bioRxiv2022

A bivalent EBV vaccine induces neutralizing antibodies that block B and epithelial cell infection and confer immunity in humanized mice

Epstein Barr virus (EBV) is the major cause of infectious mononucleosis and is associated with several human cancers. Despite its prevalence and major impact on human health, there are currently no specific vaccines or treatments. Four viral glycoproteins, gp 350 and gH/gL/gp42 mediate entry into the major sites of viral replication, B cells and epithelial cells. Here, we designed a nanoparticle vaccine displaying these proteins and show that it elicits potent neutralizing antibodies that protect against infection in vivo. Based on structural analyses, we designed single chain gH/gL and gH/gL/gp42 proteins that were each fused to bacterial ferritin to form a self-assembling nanoparticles. X-ray crystallographic analysis revealed that single chain gH/gL and gH/gL/gp42 adopted a similar conformation to the wild type proteins, and the protein spikes were observed by electron microscopy. Single chain gH/gL or gH/gL/gp42 nanoparticle vaccines were constructed to ensure product homogeneity needed for clinical development. These vaccines elicited neutralizing antibodies in mice, ferrets, and non-human primates that inhibited EBV entry into both B cells and epithelial cells. When mixed with a previously reported gp350 nanoparticle vaccine, gp350D123, no immune competition was observed. To confirm its efficacy in vivo, humanized mice were challenged with EBV after passive transfer of IgG from mice vaccinated with control, gH/gL/gp42+gp350D123 or gH/gL+gp350D123 nanoparticles. While all control animals (6/6) were infected, only one mouse in each vaccine group that received immune IgG had transient low level viremia (1/6). Furthermore, no EBV lymphomas were detected in immune animals in contrast to non-immune controls. This bivalent EBV nanoparticle vaccine represents a promising candidate to prevent EBV infection and EBV-related malignancies in humans. One sentence summaryA bivalent gp350 and gH/gL/gp42 nanoparticle vaccine elicits neutralizing antibodies that protect against EBV infection and EBV lymphoma in vivo.

immunology↗

bioRxiv2021

Precise annotation of Drosophila mitochondrial genomes leads to insights into AT-rich regions

In the present study, we performed precise annotation of Drosophila melanogaster, D. simulans, D. grimshawi, Bactrocera oleae mitochondrial (mt) genomes by pan RNA-seq analysis. Our new annotations corrected or modified some of the previous annotations and two important findings were reported for the first time, including the discovery of the conserved polyA(+) and polyA(-) motifs in the control regions (CRs) of insect mt genomes and the adding of CCAs to the 3 ends of two antisense tRNAs in D. melanogaster mt genome. Using PacBio cDNA-seq data from D. simulans, we precisely annotated the Transcription Initiation Sites (TISs) of the mt Heavy and Light strands in Drosophila mt genomes and reported that the polyA(+) and polyA(-) motifs in the CRs are associated with TISs. The discovery of the conserved polyA(+) and polyA(-) motifs provides insights into many polyA and polyT sequences in CRs of insect mt genomes, leading to reveal the mt transcription and its regulation in invertebrates. In addition, we provided a high-quality, well-curated and precisely annotated D. simulans mt genome (GenBank: MN611461), which should be included into the NCBI RefSeq database to replace the current reference genome NC_005781.

bioinformatics↗

bioRxiv2021

Full-length Genome of the Ogataea polymorpha strain HU-11 reveals large duplicated segments in subtelomeic regions

BackgroundCurrently, methylotrophic yeasts (e.g., Pichia pastoris, Ogataea polymorpha, and Candida boindii) are subjects of intense genomics studies in basic research and industrial applications. In the genus Ogataea, most research is focused on three basic O. polymorpha strains--CBS4732, NCYC495, and DL-1. However, the relationship between CBS4732, NCYC495, and DL-1 remains unclear, as the genomic differences between them have not be exactly determined without their high-quality complete genomes. As a nutritionally deficient mutant derived from CBS4732, the O. polymorpha strain CBS4732 ura3{Delta} (named HU-11) is being used for high-yield production of several important proteins or peptides. HU-11 has the same reference genome as CBS4732 (noted as HU-11/CBS4732), because the only genomic difference between them is a 5-bp insertion. ResultsIn the present study, we have assembled the full-length genome of O. polymorpha HU-11/CBS4732 using high-depth PacBio and Illumina data. Long terminal repeat (LTR) retrotransposons, rDNA, 5 and 3 telomeric, subtelomeric, low complexity and other repeat regions were curated to improve the genome quality. Particularly, we detected large duplicated segments (LDSs) in the subtelomeric regions and exactly determined all the structural variations (SVs) between CBS4732 and NCYC495. New findings mainly include(1) the genomic differences between HU-11/CBS4732 and NCYC495 include single nucleotide polymorphisms, small insertions and deletions, and only three SVs; (2) six genes were incorporated into CBS4732 from Cyberlindnera jadinii by horizontal gene transfer and may bring HU-11/CBS4732 new biological functions or physiological properties; (3) many recombination events may have occurred on chromosome 4 and 5 of CBS4732 and NCYC495 ancestors and two large segments were acquired by CBS4732 and NCYC495 from chromosome 6 and C. jadinii during recombination, respectively; and (4) the genome expansion in methylotrophic yeasts is mainly driven by large segment duplication in subtelomeric regions. ConclusionsThe present study preliminarily revealed the complex relationship between CBS4732, NCYC495, and DL-1. The new findings provide new opportunities for in-depth understanding of genome evolution in methylotrophic yeasts and lay the foundations for the industrial applications of O. polymorpha CBS4732, NCYC495, DL-1, and their derivative strains. The full-length genome of the O. polymorpha strain HU-11/CBS4732 should be included into the NCBI RefSeq database for future studies of Ogataea spp..

bioinformatics↗

bioRxiv2020

The propofol binding sites of prokaryotic voltage-gated sodium channels

Propofol, one of the most commonly used intravenous general anesthetics, modulates neuronal function by interacting with ion channels. The mechanisms that link propofol binding to the modulation of distinct ion channel states, however, are not understood. To tackle this problem, we investigated prokaryotic ancestors of eukaryotic voltage-gated Na+ channels (Navs) using unbiased photoaffinity labeling with a photoacitivatable propofol analog (AziPm), electrophysiological methods and mutagenesis. The results directly demonstrate conserved propofol binding sites involving the S4 voltage sensors and the S4-S5 linkers in NaChBac and NavMs, and also suggest state-dependent changes at these sites. Then, using molecular dynamics simulations to elucidate the structural basis of propofol modulation, we show that the S4 voltage sensors and the S4-S5 linkers shape two distinct propofol binding sites in a conformation-dependent manner. These interactions help explain how propofol binding promotes activation-coupled inactivation to inhibit Nav channel function.

biophysics↗

bioRxiv2020

Mechanistic insights into volatile anesthetic modulation of K2P channels

K2P potassium channels are known to be modulated by volatile anesthetic (VA) drugs and play important roles in clinically relevant effects that accompany general anesthesia. Here, we utilize a photoaffinity analog of the VA isoflurane to identify a VA binding site in the TREK1 K2P channel. The functional importance of the identified site was validated by mutagenesis and biochemical modification. Molecular dynamic simulations of TREK1 in the presence of VA found multiple neighboring residues on TREK1 TM2, TM3 and TM4 that contribute to anesthetic binding. The identified VA binding region contains residues that play roles in the mechanisms by which heat, mechanical stretch, and pharmacological modulators alter TREK1 channel activity and overlaps with positions found to modulate TASK K2P channel VA sensitivity. Our findings define molecular contacts that mediate VA binding to TREK1 channels and suggest a mechanistic basis to explain how K2P channels are modulated by VAs.Competing Interest StatementThe authors have declared no competing interest.View Full Text

pharmacology and toxicology↗

bioRxiv2020

Subphase Material Stabilizes Films of Pulmonary Surfactant

When compressed by the shrinking alveolar surface area during exhalation, films of pulmonary surfactant in situ reduce surface tension to levels, at which surfactant monolayers collapse from the surface in vitro. Vesicles of pulmonary surfactant added below these monolayers slow collapse. X-ray scattering here determined the structural changes that improve stability. Grazing incidence X-ray diffraction on monolayers of extracted calf surfactant detected an ordered phase. Mixtures of dipalmitoyl phosphatidylcholine and cholesterol, but not the phospholipid alone, mimic that structure. At concentrations that stabilize the monolayers, vesicles in the subphase had no effect on the unit cell, and the film remained monomolecular. The added vesicles, however, produced a concentration-dependent increase in the diffracted intensity. These results suggest that the enhanced resistance to collapse results from components of an ordered interfacial phase which partition from subphase to the surface, increasing the area of the ordered structure. SIGNIFICANCELow alveolar surface tensions are essential for maintaining the integrity of the pulmonary air-sacks during normal breathing. Films of pulmonary surfactant cause the low tensions. The interfacial structures required for the low surface tensions remain uncertain. These studies used X-ray scattering to determine the initial structure of pulmonary surfactant monolayers, and to establish how vesicles of pulmonary surfactant enhance the ability of those initial monolayers to sustain low tensions. The initial monolayers contained ordered structures that differ from the crystalline forms widely speculated to occur in alveolar films. The added vesicles had no effect on the local structure of the initial monolayer, but substantially increased the area of the ordered regions. This structural change reasonably explains the functional improvement.

biophysics↗

bioRxiv2019

Precise annotation of human, chimpanzee, rhesus macaque and mouse mitochondrial genomes using 5’ and 3’ end small RNAs

Using 5 and 3 end small RNAs, we annotated human, chimpanzee, rhesus macaque and mouse mitochondrial genomes at 1 base-pair (bp) resolution to cover both strands of the mammalian mitochondrial genome entirely without leaving any gaps or overlaps. The precise annotation of all coding and non-coding genes (e.g. ncMT1, MDL2 and MDL1AS) led to the discovery of novel functions and mechanisms of mitochondrion. In this study, we defined the conserved sequence block (CSB) region to span five CSBs (CSB1, CSB2, CSB3, LSP and HSP) and identified the motifs of five CSBs in the mitochondrial displacement loop (D-loop) regions of 52 mammals. The conserved arrangement of these five CSBs in 17 primates inspired us to investigate the function of the mtDNA D-loop, which has been puzzling scientists for more than 50 years. We found that 5 sRNAs of MDL1AS control the expression levels of mitochondrial genes as a whole by a negative feedback mechanism. Thus, the precise annotations of three CSBs (CSB2, LSP and HSP) in more species will help to understand the function of the mtDNA D-loop. The precision annotation of animal mitochondrial genomes also provides abundant information for studying the molecular phylogenetics and evolution of animals.

bioinformatics↗

bioRxiv2018

Using pan RNA-seq analysis to reveal the ubiquitous existence of 5′ end and 3′ end small RNAs

In this study, we used pan RNA-seq analysis to reveal the ubiquitous existence of 5 end and 3 end small RNAs. 5 and 3 sRNAs alone can be used to annotate mitochondrial with 1-bp resolution and nuclear non-coding genes and identify new steady-state RNAs, which are usually from functional genes. Using 5, 3 and intronic sRNAs, we revealed that the enzymatic dsRNA cleavage and RNAi could involve in the RNA degradation and gene expression regulation of U1 snRNA in human. The further study of 5, 3 and intronic sRNAs help rediscover double-stranded RNA (dsRNA) cleavage, RNA interference (RNAi) and the regulation of gene expression, which challenges the classical theories. In this study, we provided a simple and cost effective way for the annotation of mitochondrial and nuclear non-coding genes and the identification of new steady-state RNAs, particularly long non-coding RNAs (lncRNAs). We also provided a different point of view for cancer and virus, based on the new discoveries of dsRNA cleavage, RNAi and the regulation of gene expression.

bioinformatics↗

bioRxiv2017

Complemented palindrome small RNAs first discovered from SARS coronavirus

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

genomics↗