Biology subjects

Behnke, J.

Publications and source records attributed to Behnke, J..

4 recordsLinked to original sources

bioRxiv2026

Species-specific responses of helminths to temperature and moisture: long-term and multi-scale analyses in a free-living rodent

Parasite infections in wildlife vary across time and space due to interactions among host biology, ecological processes, and climatic variability. Under ongoing climate change, understanding how temperature, precipitation, or humidity influences parasite dynamics is important for predicting shifts in infection patterns and host-parasite interactions. Here, we examine how variation in climatic conditions is associated with helminth infections in a free-living rodent, the bank vole (Myodes glareolus), across 17 years and multiple spatial scales. Using zero-inflated generalised linear models, we quantified the effects of climatic variables on individual parasite burden. Climatic conditions (temperature and humidity or precipitation) affected helminth infections across all analysed scales, though the strength and direction of these effects differed among parasite species and between temporal and spatial scales. In the temporal dataset, parasite load was associated with seasonal variation in weather conditions, whereas in the spatial datasets, infection levels were linked to yearly average climatic variables. The differences reflect species-specific parasites life histories and transmission strategies. Our findings highlight the importance of analysing individual parasite species rather than overall parasite load or aggregated infection indices when assessing the impacts of climatic variation on host-parasite dynamics.

ecology↗

bioRxiv2020

Zoonotic viruses in three species of voles (Microtus spp.) from Poland

Rodents are known to be reservoir hosts for a plethora of zoonotic viruses and therefore play a significant role in the dissemination of these pathogens. We trapped three vole species (Microtus arvalis, M. oeconomus and M. agrestis) in N.E. Poland, all of which are widely distributed species in Europe, and, using immunofluorescence assays, we assessed serum samples for the presence of antibodies to hantaviruses, arenaviruses and cowpox viruses (CPXV). We detected antibodies against CPXV and Puumala virus (PUUV), overall seroprevalence of combined viral infections of 18.2% [10.5-29.3] and mostly attributed to CPXV. Antibodies to Tula hantavirus, typical for Microtus voles, are known to cross-react strongly with the PUUV antigen used in PUUV screening, but we detected only one PUUV/TULV cross-reaction in Microtus arvalis (1.3% [0.1-7.9]). We found antibodies against CPXV in all three Microtus spp. Seroprevalence was similar in all vole species. There were no significant differences in seroprevalence between the sexes and among host age categories. Our results contribute to the increasing understanding of CPXV abundance in voles in Europe, and confirm that CPXV circulates also in Microtus spp. voles in NE Poland.

microbiology↗

bioRxiv2020

Production of the Short Chain Fatty Acid, Acetic Acid/Acetate from Ethanol Metabolism Activates NMDAR

Binge alcohol consumption elicits robust sympathoexcitation and excitatory neuronal output. However, the central mechanism that mediates these effects remains elusive. We investigated the effects of ethanol metabolism within the central nucleus of the amygdala (CeA) on sympathoexcitation, and elucidated the role of acetate in these excitatory responses. In vivo arterial blood pressure, heart rate and sympathetic nerve activity responses to CeA microinjected ethanol or acetate with appropriate inhibitors/antagonists were tracked. In vitro whole-cell electrophysiology recording responses to acetate in CeA neurons with axon projecting to the rostral ventrolateral medulla (CeA-RVLM) were investigated, and cytosolic calcium responses in primary neuronal cultures were quantified. We demonstrate that in Sprague Dawley rats, local brain metabolism of ethanol in the CeA to acetic acid/acetate elicits sympathoexcitatory responses in vivo through activation of NMDA receptor (NMDAR). Alcohol dehydrogenase or aldehyde dehydrogenase inhibition using fomepizole or cyanamide and NMDAR antagonism using AP5 or memantine blunted these effects. Whole-cell patch-clamp recordings in brain slices containing autonomic CeA-RVLM neurons revealed a dose-dependent increase in neuronal excitability in response to acetate. NMDAR antagonists suppressed the acetate-induced increase in CeA-RVLM neuronal excitability, and memantine suppressed the direct activation of NMDAR-mediated inward currents by acetate in brain slices. We observed that acetate increased cytosolic Ca2+ in a time-dependent manner in primary neuronal cell cultures. The acetate enhancement of calcium signaling was abolished by memantine. These findings suggest that within the CeA, ethanol is sympathoexcitatory through local brain metabolism, which generates acetic acid/acetate leading to activation of NMDAR. NEW AND NOTEWORTHYBrain ethanol metabolism to acetic acid (vinegar)/acetate causes activation of N-methyl-D-aspartate receptors (NMDARs) in the central nucleus of the amygdala and elicits sympathoexcitatory responses. This excitatory mechanism is opposite to the inhibitory effects of ethanol at NMDAR. Understanding the active compounds that arise from ethanol metabolism, and the molecular mechanisms by which they influence alcohol reward and cardiovascular function, may be beneficial in developing targeted intervention strategies for both alcohol use disorder and its cardiovascular sequelae. Graphical Figure O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=172 SRC="FIGDIR/small/212597v4_ufig1.gif" ALT="Figure 1"> View larger version (36K): org.highwire.dtl.DTLVardef@18d8ec9org.highwire.dtl.DTLVardef@996b70org.highwire.dtl.DTLVardef@5cbecaorg.highwire.dtl.DTLVardef@f1cd4b_HPS_FORMAT_FIGEXP M_FIG Proposed mechanisms for ethanol and acetate induced increases in sympathoexcitation within the central nucleus of the amygdala (CeA). Abbreviations: Acetic acid (HOAc), acetate (-OAc), ADH (alcohol dehydrogenase), ALDH (aldehyde dehydrogenase), BBB (blood brain barrier), FOM (fomepizole), CYAN (cyanamide), CYP450 (cytochrome P450), IML (intermediolateral nucleus), RVLM (rostral ventrolateral medulla), SNA (sympathetic nerve activity). C_FIG

physiology↗

bioRxiv2016

Recombinant DNA resources for the comparative genomics of Ancylostoma ceylanicum.

We describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm, Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5 -linker - GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematode C. elegans and A. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organism C. elegans and closely related parasitic species. We discuss the potential and relevance of Ancylostoma ceylanicum data and resources generated by the recombinant DNA approach.

genomics↗